Morpholino

MO1-oma1

ID

ZDB-MRPHLNO-171122-4

Name

MO1-oma1

Previous Names

OMA1 TB (1)

Target

oma1 (1)

Sequence

5' - TCTTCTGCAAGGGCTTCAGCACCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-oma1

Expressed Gene	Anatomy	Figures
oma1	whole organism	Fig. 4 from Bohovych et al., 2015

Phenotype

Phenotype resulting from MO1-oma1

Phenotype	Fish	Figures
aerobic respiration decreased process quality, abnormal	AB + MO1-oma1	Fig. 5 from Bohovych et al., 2015
blood circulation disrupted, abnormal	AB + MO1-oma1	Fig. 5 from Bohovych et al., 2015
brain structure, abnormal	AB + MO1-oma1	Fig. 5 from Bohovych et al., 2015
eye decreased diameter, abnormal	AB + MO1-oma1	Fig. 5 from Bohovych et al., 2015
eye decreased size, abnormal	AB + MO1-oma1	Fig. 4 from Bohovych et al., 2015
head decreased size, abnormal	AB + MO1-oma1	Fig. 5 from Bohovych et al., 2015
heart structure, abnormal	AB + MO1-oma1	Fig. 5 from Bohovych et al., 2015
heart contraction decreased rate, abnormal	AB + MO1-oma1	Fig. 5 from Bohovych et al., 2015
heart looping disrupted, abnormal	AB + MO1-oma1	Fig. 5 from Bohovych et al., 2015
pericardium edematous, abnormal	AB + MO1-oma1	Fig. 4 , Fig. 5 from Bohovych et al., 2015
whole organism oma1 expression decreased amount, abnormal	AB + MO1-oma1	Fig. 4 from Bohovych et al., 2015
whole organism decreased length, abnormal	AB + MO1-oma1	Fig. 4 from Bohovych et al., 2015
whole organism oma1 expression increased amount, abnormal	AB + MO1-oma1	Fig. 4 from Bohovych et al., 2015
whole organism mitochondrion decreased functionality, abnormal	AB + MO1-oma1	Fig. 5 from Bohovych et al., 2015

Phenotype of all Fish created by or utilizing MO1-oma1

Phenotype	Fish	Conditions	Figures
blood circulation disrupted, abnormal	AB + MO1-oma1	standard conditions	Fig. 5 from Bohovych et al., 2015
whole organism oma1 expression decreased amount, abnormal	AB + MO1-oma1	standard conditions	Fig. 4 from Bohovych et al., 2015
head decreased size, abnormal	AB + MO1-oma1	standard conditions	Fig. 5 from Bohovych et al., 2015
whole organism mitochondrion decreased functionality, abnormal	AB + MO1-oma1	standard conditions	Fig. 5 from Bohovych et al., 2015
whole organism decreased length, abnormal	AB + MO1-oma1	standard conditions	Fig. 4 from Bohovych et al., 2015
eye decreased size, abnormal	AB + MO1-oma1	standard conditions	Fig. 4 from Bohovych et al., 2015
pericardium edematous, abnormal	AB + MO1-oma1	standard conditions	Fig. 4 , Fig. 5 from Bohovych et al., 2015
aerobic respiration decreased process quality, abnormal	AB + MO1-oma1	standard conditions	Fig. 5 from Bohovych et al., 2015
heart structure, abnormal	AB + MO1-oma1	standard conditions	Fig. 5 from Bohovych et al., 2015
heart looping disrupted, abnormal	AB + MO1-oma1	standard conditions	Fig. 5 from Bohovych et al., 2015
brain structure, abnormal	AB + MO1-oma1	standard conditions	Fig. 5 from Bohovych et al., 2015
eye decreased diameter, abnormal	AB + MO1-oma1	standard conditions	Fig. 5 from Bohovych et al., 2015
whole organism oma1 expression increased amount, abnormal	AB + MO1-oma1	standard conditions	Fig. 4 from Bohovych et al., 2015
heart contraction decreased rate, abnormal	AB + MO1-oma1	standard conditions	Fig. 5 from Bohovych et al., 2015

Citations