Morpholino

MO1-qki2

ID
ZDB-MRPHLNO-171116-2
Name
MO1-qki2
Previous Names
  • 5?UTR (1)
Target
Sequence
5' - GGGTTTTAATGTGTTTCCCCGTATT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-qki2
No data available
Phenotype
Phenotype resulting from MO1-qki2
No data available
Phenotype of all Fish created by or utilizing MO1-qki2
Phenotype Fish Conditions Figures
whole organism tpm3 expression decreased amount, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 4 with image from Bonnet et al., 2017
slow muscle cell myosin complex aggregated, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 1 with image from Bonnet et al., 2017
slow muscle cell somite 14 ab-f59 labeling spatial pattern, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 3 with image from Bonnet et al., 2017
slow muscle cell skeletal muscle myosin thick filament assembly decreased process quality, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 3 with image from Bonnet et al., 2017
slow muscle cell striated muscle myosin thick filament decreased length, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 3 with image from Bonnet et al., 2017
slow muscle cell somite 8 ab-f59 labeling spatial pattern, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 3 with image from Bonnet et al., 2017
slow muscle cell striated muscle thin filament decreased length, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 3 with image from Bonnet et al., 2017
slow muscle cell skeletal muscle myofibril decreased length, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 1 with image from Bonnet et al., 2017
slow muscle cell skeletal muscle myofibril decreased thickness, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 1 with image from Bonnet et al., 2017
slow muscle cell skeletal muscle cell differentiation decreased process quality, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 4 with image from Bonnet et al., 2017
slow muscle cell ab1-actn labeling spatial pattern, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 3 with image from Bonnet et al., 2017
slow muscle cell ab-f59 labeling spatial pattern, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 3 with image from Bonnet et al., 2017
slow muscle cell skeletal myofibril assembly decreased process quality, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 1 with image from Bonnet et al., 2017
slow muscle cell skeletal muscle myofibril malformed, abnormal qkiat31954/t31954 + MO1-qki2 standard conditions Fig. 1 with image from Bonnet et al., 2017
Citations