Morpholino

MO1-nup210

ID
ZDB-MRPHLNO-171107-1
Name
MO1-nup210
Previous Names
None
Target
Sequence
5' - CACGAGCAGACCGACCTTCTCCATA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nup210
No data available
Phenotype
Phenotype resulting from MO1-nup210
Phenotype of all Fish created by or utilizing MO1-nup210
Phenotype Fish Conditions Figures
muscle cell skeletal muscle myofibril structure, abnormal TL + MO1-nup210 control Fig. 1 with imageFig. 3 with image from Raices et al., 2017
muscle cell undulate, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
somite U-shaped, abnormal TL + MO1-nup210 control Fig. 1 with imageFig. 4 with imageFig. 5 with image from Raices et al., 2017
muscle cell detached from myoseptum, abnormal TL + MO1-nup210 control Fig. 1 with imageFig. 2 with image from Raices et al., 2017
heart edematous, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
skeletal muscle fiber development decreased process quality, abnormal TL + MO1-nup210 control Fig. 2 with image from Raices et al., 2017
somite decreased width, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
muscle disorganized, abnormal TL + MO1-nup210 control Fig. 3 with imageFig. 4 with imageFig. 5 with image from Raices et al., 2017
whole organism decreased length, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
somite decreased length, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
myotome apoptotic process increased occurrence, abnormal TL + MO1-nup210 control Fig. 3 with image from Raices et al., 2017
caudal fin curved, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
skeletal muscle fiber development decreased process quality, abnormal TL + MO1-nup210 chemical treatment by environment: Cyclopamine Fig. 2 with image from Raices et al., 2017
muscle cell structure, abnormal TL + MO1-nup210 control Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 4 with imageFig. 5 with image from Raices et al., 2017
muscle cell structure, exacerbated TL + MO1-nup210 + MO1-pom121 control Fig. 5 with image from Raices et al., 2017
somite U-shaped, exacerbated TL + MO1-nup210 + MO1-pom121 control Fig. 5 with image from Raices et al., 2017
muscle disorganized, exacerbated TL + MO1-nup210 + MO1-pom121 control Fig. 5 with image from Raices et al., 2017
somite U-shaped, exacerbated TL + MO1-nup210 + MO1-trip6 control Fig. 4 with image from Raices et al., 2017
muscle disorganized, exacerbated TL + MO1-nup210 + MO1-trip6 control Fig. 4 with image from Raices et al., 2017
muscle cell structure, exacerbated TL + MO1-nup210 + MO1-trip6 control Fig. 4 with image from Raices et al., 2017
Citations