Morpholino

MO1-tbc1d23

ID
ZDB-MRPHLNO-171027-2
Name
MO1-tbc1d23
Previous Names
None
Target
Sequence
5' - CTTCCCCTACAGCATCCGCCATTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbc1d23
Expressed Gene Anatomy Figures
elavl3 Fig 6 with image from Liu et al., 2020
Fig. 1 with image,  Fig. 6 with image from Huang et al., 2019
gfap Fig. S1 from Huang et al., 2019
Phenotype
Phenotype resulting from MO1-tbc1d23
Phenotype Fish Figures
brain EGFP expression decreased amount, abnormal knu3Tg + MO1-tbc1d23 Fig. 1 with image from Huang et al., 2019
brain elavl3 expression decreased amount, abnormal WT + MO1-tbc1d23 Fig 6 with image from Liu et al., 2020
Fig. 1 with image,  Fig. 6 with image from Huang et al., 2019
brain decreased size, abnormal AB + MO1-tbc1d23 Fig. 4 from Marin-Valencia et al., 2017
brainstem decreased size, abnormal AB + MO1-tbc1d23 Fig. 4 from Marin-Valencia et al., 2017
brainstem morphology, abnormal rw0130aTg + MO1-tbc1d23 Fig. 4 from Marin-Valencia et al., 2017
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO1-tbc1d23 Fig 6 with image from Liu et al., 2020
Fig. 1 with image,  Fig. 6 with image from Huang et al., 2019
CaP motoneuron axon morphology, abnormal ml2Tg + MO1-tbc1d23 Fig 6 with image from Liu et al., 2020
caudal fin curved, abnormal WT + MO1-tbc1d23 Fig. S1 from Huang et al., 2019
cerebellum decreased size, abnormal AB + MO1-tbc1d23 Fig. 4 from Marin-Valencia et al., 2017
cerebellum morphology, abnormal WT + MO1-tbc1d23 Fig. 1 with image,  Fig. S1 from Huang et al., 2019
Fig. 4 from Marin-Valencia et al., 2017
eye decreased size, abnormal AB + MO1-tbc1d23 Fig. 4 from Marin-Valencia et al., 2017
forebrain morphology, abnormal knu3Tg + MO1-tbc1d23 Fig. 1 with image,  Fig. S1 from Huang et al., 2019
Fig. 4 from Marin-Valencia et al., 2017
fourth ventricle increased size, abnormal AB + MO1-tbc1d23 Fig. S1 from Huang et al., 2019
Fig. 4 from Marin-Valencia et al., 2017
midbrain decreased size, abnormal AB + MO1-tbc1d23 Fig 6 with image from Liu et al., 2020
midbrain morphology, abnormal WT + MO1-tbc1d23 Fig. 1 with image,  Fig. S1 from Huang et al., 2019
post-vent region increased curvature, abnormal AB + MO1-tbc1d23 Fig. 4 from Marin-Valencia et al., 2017
swimming behavior decreased occurrence, abnormal WT + MO1-tbc1d23 Fig. S2 from Huang et al., 2019
swimming behavior process quality, abnormal WT + MO1-tbc1d23 Fig. S2 from Huang et al., 2019
trunk gfap expression decreased amount, abnormal WT + MO1-tbc1d23 Fig. S1 from Huang et al., 2019
ventricular system increased size, abnormal WT + MO1-tbc1d23 Fig. S1 from Huang et al., 2019
whole organism EGFP expression decreased amount, abnormal knu3Tg + MO1-tbc1d23 Fig 6 with image from Liu et al., 2020
whole organism elavl3 expression decreased amount, abnormal AB + MO1-tbc1d23 Fig 6 with image from Liu et al., 2020
Fig. 1 with image,  Fig. 6 with image from Huang et al., 2019
Phenotype of all Fish created by or utilizing MO1-tbc1d23
Phenotype Fish Conditions Figures
brainstem decreased size, abnormal AB + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
post-vent region increased curvature, abnormal AB + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
brain decreased size, abnormal AB + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
eye decreased size, abnormal AB + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
brain elavl3 expression decreased amount, abnormal AB + MO1-tbc1d23 standard conditions Fig 6 with image from Liu et al., 2020
midbrain decreased size, abnormal AB + MO1-tbc1d23 standard conditions Fig 6 with image from Liu et al., 2020
cerebellum decreased size, abnormal AB + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
fourth ventricle increased size, abnormal AB + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
whole organism elavl3 expression decreased amount, abnormal AB + MO1-tbc1d23 standard conditions Fig 6 with image from Liu et al., 2020
fourth ventricle increased size, abnormal WT + MO1-tbc1d23 standard conditions Fig. S1 from Huang et al., 2019
whole organism elavl3 expression decreased amount, abnormal WT + MO1-tbc1d23 standard conditions Fig. 1 with image,  Fig. 6 with image from Huang et al., 2019
brain elavl3 expression decreased amount, abnormal WT + MO1-tbc1d23 standard conditions Fig. 1 with image,  Fig. 6 with image from Huang et al., 2019
midbrain morphology, abnormal WT + MO1-tbc1d23 standard conditions Fig. 1 with image,  Fig. S1 from Huang et al., 2019
caudal fin curved, abnormal WT + MO1-tbc1d23 standard conditions Fig. S1 from Huang et al., 2019
forebrain morphology, abnormal WT + MO1-tbc1d23 standard conditions Fig. 1 with image,  Fig. S1 from Huang et al., 2019
swimming behavior decreased occurrence, abnormal WT + MO1-tbc1d23 standard conditions Fig. S2 from Huang et al., 2019
ventricular system increased size, abnormal WT + MO1-tbc1d23 standard conditions Fig. S1 from Huang et al., 2019
swimming behavior process quality, abnormal WT + MO1-tbc1d23 standard conditions Fig. S2 from Huang et al., 2019
trunk gfap expression decreased amount, abnormal WT + MO1-tbc1d23 standard conditions Fig. S1 from Huang et al., 2019
cerebellum morphology, abnormal WT + MO1-tbc1d23 standard conditions Fig. 1 with image,  Fig. S1 from Huang et al., 2019
whole organism EGFP expression decreased amount, abnormal knu3Tg + MO1-tbc1d23 standard conditions Fig 6 with image from Liu et al., 2020
brain EGFP expression decreased amount, abnormal knu3Tg + MO1-tbc1d23 standard conditions Fig. 1 with image from Huang et al., 2019
midbrain morphology, abnormal knu3Tg + MO1-tbc1d23 standard conditions Fig. 1 with image from Huang et al., 2019
forebrain morphology, abnormal knu3Tg + MO1-tbc1d23 standard conditions Fig. 1 with image from Huang et al., 2019
cerebellum morphology, abnormal knu3Tg + MO1-tbc1d23 standard conditions Fig. 1 with image from Huang et al., 2019
CaP motoneuron axon morphology, abnormal ml2Tg + MO1-tbc1d23 standard conditions Fig 6 with image from Liu et al., 2020
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO1-tbc1d23 standard conditions Fig 6 with image from Liu et al., 2020
Fig. 1 with image,  Fig. 6 with image from Huang et al., 2019
cerebellum morphology, abnormal rw0130aTg + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
brainstem morphology, abnormal rw0130aTg + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
forebrain morphology, abnormal rw0130aTg + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.