Morpholino
MO1-si:ch1073-384e4.1
- ID
- ZDB-MRPHLNO-170814-1
- Name
- MO1-si:ch1073-384e4.1
- Previous Names
-
- slincR-MO (1)
- Target
- Sequence
-
5' - GACCTAAACTCGACCTTACCAGATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
splice blocking MO targeting the exon/intron boundary of slincR exon 1 ; reference: Garcia et al. (2017) PubMed:28385905, ZDB-PUB-170408-7
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-si:ch1073-384e4.1
Expressed Gene | Anatomy | Figures |
---|---|---|
adamts3 | (all 6) |
Fig. 5 ![]() |
fabp2 |
Fig. 5 ![]() |
|
fgfr3 |
Fig. 5 ![]() |
|
notch3 | (all 5) |
Fig. 5 ![]() |
sfrp2 |
Fig. 5 ![]() |
1 - 5 of 6 Show all
Phenotype
Phenotype resulting from MO1-si:ch1073-384e4.1
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-si:ch1073-384e4.1
1 - 5 of 24 Show all
Citations
- Garcia, G.R., Shankar, P., Dunham, C.L., Garcia, A., La Du, J.K., Truong, L., Tilton, S.C., Tanguay, R.L. (2018) Signaling Events Downstream of AHR Activation That Contribute to Toxic Responses: The Functional Role of an AHR-Dependent Long Noncoding RNA ( slincR) Using the Zebrafish Model. Environmental health perspectives. 126:117002
- Garcia, G.R., Goodale, B.C., Wiley, M.W., La Du, J.K., Hendrix, D.A., Tanguay, R.L. (2017) In Vivo Characterization of an AHR-Dependent Long Noncoding RNA Required for Proper Sox9b Expression.. Molecular pharmacology. 91(6):609-619
1 - 2 of 2
Show