Morpholino

MO2-sil1

ID
ZDB-MRPHLNO-170718-4
Name
MO2-sil1
Previous Names
None
Target
Sequence
5' - GGTGACTGTGTAAACAGAACAAATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splicing MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sil1
No data available
Phenotype
Phenotype resulting from MO2-sil1
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal AB + MO2-sil1 Fig. 6 from Kawahara et al., 2016
brain morphology, abnormal rw0Tg + MO2-sil1 Fig. 5 from Hathazi et al., 2021
cranial nerve III decreased object quality, abnormal rw0Tg + MO2-sil1 Fig. 5,  Fig. 6 from Hathazi et al., 2021
cranial nerve IV decreased object quality, abnormal rw0Tg + MO2-sil1 Fig. 5,  Fig. 6 from Hathazi et al., 2021
cranial nerve VI decreased object quality, abnormal rw0Tg + MO2-sil1 Fig. 5,  Fig. 6 from Hathazi et al., 2021
cranial nerve VII decreased object quality, abnormal rw0Tg + MO2-sil1 Fig. 5,  Fig. 6 from Hathazi et al., 2021
cranial nerve X decreased object quality, abnormal rw0Tg + MO2-sil1 Fig. 5,  Fig. 6 from Hathazi et al., 2021
eye decreased diameter, abnormal AB + MO2-sil1 Fig. 4 with image from Kawahara et al., 2016
eye decreased size, abnormal AB + MO2-sil1 Fig. 4 with image from Kawahara et al., 2016
myoseptum morphology, abnormal AB + MO2-sil1 Fig. 3 with image from Kawahara et al., 2016
myoseptum dag1 expression spatial pattern, abnormal AB + MO2-sil1 Fig. 3 with image from Kawahara et al., 2016
Purkinje cell decreased amount, abnormal AB + MO2-sil1 Fig. 5 with image from Kawahara et al., 2016
skeletal muscle morphology, abnormal AB + MO2-sil1 Fig. 2 with image from Kawahara et al., 2016
skeletal muscle refractivity, abnormal AB + MO2-sil1 Fig. 2 with image from Kawahara et al., 2016
skeletal muscle fiber development disrupted, abnormal AB + MO2-sil1 Fig. 3 with image from Kawahara et al., 2016
Phenotype of all Fish created by or utilizing MO2-sil1
Phenotype Fish Conditions Figures
myoseptum dag1 expression spatial pattern, abnormal AB + MO2-sil1 standard conditions Fig. 3 with image from Kawahara et al., 2016
Purkinje cell decreased amount, abnormal AB + MO2-sil1 standard conditions Fig. 5 with image from Kawahara et al., 2016
apoptotic process increased occurrence, abnormal AB + MO2-sil1 standard conditions Fig. 6 from Kawahara et al., 2016
skeletal muscle morphology, abnormal AB + MO2-sil1 standard conditions Fig. 2 with image from Kawahara et al., 2016
eye decreased size, abnormal AB + MO2-sil1 standard conditions Fig. 4 with image from Kawahara et al., 2016
skeletal muscle fiber development disrupted, abnormal AB + MO2-sil1 standard conditions Fig. 3 with image from Kawahara et al., 2016
skeletal muscle refractivity, abnormal AB + MO2-sil1 standard conditions Fig. 2 with image from Kawahara et al., 2016
myoseptum morphology, abnormal AB + MO2-sil1 standard conditions Fig. 3 with image from Kawahara et al., 2016
eye decreased diameter, abnormal AB + MO2-sil1 standard conditions Fig. 4 with image from Kawahara et al., 2016
cranial nerve III decreased object quality, abnormal rw0Tg + MO2-sil1 standard conditions Fig. 5,  Fig. 6 from Hathazi et al., 2021
cranial nerve VII decreased object quality, abnormal rw0Tg + MO2-sil1 standard conditions Fig. 5,  Fig. 6 from Hathazi et al., 2021
cranial nerve VII physical object quality, ameliorated rw0Tg + MO2-sil1 chemical treatment by environment: L-serine Fig. 6 from Hathazi et al., 2021
cranial nerve VI physical object quality, ameliorated rw0Tg + MO2-sil1 chemical treatment by environment: L-serine Fig. 6 from Hathazi et al., 2021
cranial nerve X physical object quality, ameliorated rw0Tg + MO2-sil1 chemical treatment by environment: L-serine Fig. 6 from Hathazi et al., 2021
cranial nerve VI decreased object quality, abnormal rw0Tg + MO2-sil1 standard conditions Fig. 5,  Fig. 6 from Hathazi et al., 2021
brain morphology, abnormal rw0Tg + MO2-sil1 standard conditions Fig. 5 from Hathazi et al., 2021
cranial nerve X decreased object quality, abnormal rw0Tg + MO2-sil1 standard conditions Fig. 5,  Fig. 6 from Hathazi et al., 2021
cranial nerve IV decreased object quality, abnormal rw0Tg + MO2-sil1 standard conditions Fig. 5,  Fig. 6 from Hathazi et al., 2021
neuromuscular junction development process quality, ameliorated slc24a5b1/b1 + MO2-sil1 chemical treatment by environment: L-serine Fig. 6 from Hathazi et al., 2021
vertical myoseptum synapse assembly disrupted, abnormal slc24a5b1/b1 + MO2-sil1 standard conditions Fig. 5,  Fig. 6 from Hathazi et al., 2021
Fig. 6 from Phan et al., 2018
neuromuscular junction development process quality, abnormal slc24a5b1/b1 + MO2-sil1 standard conditions Fig. 5,  Fig. 6 from Hathazi et al., 2021
skeletal muscle cell morphology, abnormal slc24a5b1/b1 + MO2-sil1 standard conditions Fig. 6 from Hathazi et al., 2021
vertical myoseptum synapse assembly occurrence, ameliorated slc24a5b1/b1 + MO2-sil1 chemical treatment by environment: L-serine Fig. 6 from Hathazi et al., 2021
post-vent region increased curvature, abnormal slc24a5b1/b1 + MO2-sil1 standard conditions Fig. 5,  Fig. 6 from Hathazi et al., 2021
skeletal muscle cell morphology, abnormal slc24a5b1/b1 + MO2-sil1 chemical treatment by environment: L-serine Fig. 6 from Hathazi et al., 2021
motor neuron presynapse ab-sv2 labeling spatial pattern, abnormal slc24a5b1/b1 + MO2-sil1 standard conditions Fig. 6 from Phan et al., 2018
whole organism L-serine decreased amount, abnormal slc24a5b1/b1 + MO2-sil1 standard conditions Fig. 5 from Hathazi et al., 2021
post-vent region increased curvature, abnormal slc24a5b1/b1 + MO2-sil1 chemical treatment by environment: L-serine Fig. 6 from Hathazi et al., 2021
whole organism phgdh expression decreased amount, abnormal slc24a5b1/b1 + MO2-sil1 standard conditions Fig. 5 from Hathazi et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.