Morpholino

MO1-nme3

ID

ZDB-MRPHLNO-170606-1

Name

MO1-nme3

Previous Names

Target

Sequence

5' - ATGCTGTATTAGGGTTCTCACCTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-nme3

Expressed Gene	Anatomy	Figures
myl7	heart	Fig. 4 from Hoff et al., 2018
spaw	lateral plate mesoderm left side	Fig. 4 from Hoff et al., 2018

Phenotype

Phenotype resulting from MO1-nme3

Phenotype	Fish	Figures
cardiac ventricle heart contraction process quality, abnormal	WT + MO1-nme3	Fig. 6 from Abu-Taha et al., 2017
determination of left/right symmetry process quality, abnormal	WT + MO1-nme3	Fig. 4 from Hoff et al., 2018
heart looping process quality, abnormal	WT + MO1-nme3	Fig. 4 from Hoff et al., 2018
lateral plate mesoderm right side spaw expression mislocalised, abnormal	WT + MO1-nme3	Fig. 4 from Hoff et al., 2018
pericardium edematous, abnormal	WT + MO1-nme3	Fig. 6 from Abu-Taha et al., 2017
post-vent region increased curvature, abnormal	WT + MO1-nme3	Fig. 4 from Hoff et al., 2018
pronephric tubule cilium decreased length, abnormal	WT + MO1-nme3	Fig. 5 from Hoff et al., 2018
pronephros cystic, abnormal	li1Tg + MO1-nme3	Fig. 4 from Hoff et al., 2018
whole organism 3',5'-cyclic AMP decreased amount, abnormal	WT + MO1-nme3	Fig. 6 from Abu-Taha et al., 2017

Phenotype of all Fish created by or utilizing MO1-nme3

Phenotype	Fish	Conditions	Figures
cardiac ventricle heart contraction process quality, abnormal	WT + MO1-nme3	standard conditions	Fig. 6 from Abu-Taha et al., 2017
lateral plate mesoderm right side spaw expression mislocalised, abnormal	WT + MO1-nme3	standard conditions	Fig. 4 from Hoff et al., 2018
pronephric tubule cilium decreased length, abnormal	WT + MO1-nme3	standard conditions	Fig. 5 from Hoff et al., 2018
heart looping process quality, abnormal	WT + MO1-nme3	standard conditions	Fig. 4 from Hoff et al., 2018
post-vent region increased curvature, abnormal	WT + MO1-nme3	standard conditions	Fig. 4 from Hoff et al., 2018
determination of left/right symmetry process quality, abnormal	WT + MO1-nme3	standard conditions	Fig. 4 from Hoff et al., 2018
whole organism 3',5'-cyclic AMP decreased amount, abnormal	WT + MO1-nme3	standard conditions	Fig. 6 from Abu-Taha et al., 2017
pericardium edematous, abnormal	WT + MO1-nme3	standard conditions	Fig. 6 from Abu-Taha et al., 2017
pronephros cystic, abnormal	li1Tg + MO1-nme3	standard conditions	Fig. 4 from Hoff et al., 2018
cardiac ventricle heart contraction process quality, abnormal	WT + MO1-nme3 + MO2-nme2b.1	standard conditions	Fig. 6 from Abu-Taha et al., 2017

Citations