Morpholino

MO3-abhd12

ID
ZDB-MRPHLNO-170308-6
Name
MO3-abhd12
Previous Names
  • MO-E10I10 (1)
Target
Sequence
5' - GGACTGGTATTCTGACCATGGAGAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-abhd12
Expressed Gene Anatomy Figures
mbpa Fig. 5 from Tingaud-Sequeira et al., 2017
Phenotype
Phenotype resulting from MO3-abhd12
Phenotype Fish Figures
anterior lateral line neuromast GFP expression decreased amount, abnormal s356tTg + MO3-abhd12 Fig. 6 from Tingaud-Sequeira et al., 2017
anterior lateral line neuromast decreased amount, abnormal s356tTg + MO3-abhd12 Fig. 6 from Tingaud-Sequeira et al., 2017
central nervous system glial cell EGFP expression absent, abnormal ue2Tg + MO3-abhd12 Fig. 5 from Tingaud-Sequeira et al., 2017
central nervous system myelination disrupted, abnormal WT + MO3-abhd12 Fig. 5 from Tingaud-Sequeira et al., 2017
eye decreased size, abnormal WT + MO3-abhd12 Fig. 4,  Fig. S9 from Tingaud-Sequeira et al., 2017
eye photoreceptor cell decreased amount, abnormal WT + MO3-abhd12 Fig. 8 from Tingaud-Sequeira et al., 2017
glial cell myelination disrupted, abnormal ue2Tg + MO3-abhd12 Fig. 5,  Fig. S11 from Tingaud-Sequeira et al., 2017
head decreased length, abnormal WT + MO3-abhd12 Fig. S9 from Tingaud-Sequeira et al., 2017
lens opaque, abnormal WT + MO3-abhd12 Fig. 8 from Tingaud-Sequeira et al., 2017
medial longitudinal fasciculus mbpa expression decreased amount, abnormal WT + MO3-abhd12 Fig. 5 from Tingaud-Sequeira et al., 2017
posterior lateral line nerve myelinating Schwann cell mbpa expression decreased amount, abnormal WT + MO3-abhd12 Fig. 5 from Tingaud-Sequeira et al., 2017
posterior lateral line neuromast decreased amount, abnormal s356tTg + MO3-abhd12 Fig. 6 from Tingaud-Sequeira et al., 2017
posterior lateral line neuromast GFP expression decreased amount, abnormal s356tTg + MO3-abhd12 Fig. 6 from Tingaud-Sequeira et al., 2017
Purkinje cell layer corpus cerebelli morphology, abnormal WT + MO3-abhd12 Fig. 5 from Tingaud-Sequeira et al., 2017
retina layer formation disrupted, abnormal WT + MO3-abhd12 Fig. 8 from Tingaud-Sequeira et al., 2017
retinal ganglion cell layer patchy, abnormal WT + MO3-abhd12 Fig. 8 from Tingaud-Sequeira et al., 2017
retinal inner plexiform layer circular, abnormal WT + MO3-abhd12 Fig. 8 from Tingaud-Sequeira et al., 2017
retinotectal tract morphology, abnormal WT + MO3-abhd12 Fig. 8 from Tingaud-Sequeira et al., 2017
spinal cord mbpa expression decreased amount, abnormal WT + MO3-abhd12 Fig. 5 from Tingaud-Sequeira et al., 2017
swimming behavior process quality, abnormal WT + MO3-abhd12 Fig. 7 from Tingaud-Sequeira et al., 2017
thigmotaxis process quality, abnormal WT + MO3-abhd12 Fig. 7 from Tingaud-Sequeira et al., 2017
whole organism decreased length, abnormal WT + MO3-abhd12 Fig. 4,  Fig. S9 from Tingaud-Sequeira et al., 2017
Phenotype of all Fish created by or utilizing MO3-abhd12
Phenotype Fish Conditions Figures
retina layer formation disrupted, abnormal WT + MO3-abhd12 standard conditions Fig. 8 from Tingaud-Sequeira et al., 2017
retinal ganglion cell layer patchy, abnormal WT + MO3-abhd12 standard conditions Fig. 8 from Tingaud-Sequeira et al., 2017
medial longitudinal fasciculus mbpa expression decreased amount, abnormal WT + MO3-abhd12 standard conditions Fig. 5 from Tingaud-Sequeira et al., 2017
Purkinje cell layer corpus cerebelli morphology, abnormal WT + MO3-abhd12 standard conditions Fig. 5 from Tingaud-Sequeira et al., 2017
spinal cord mbpa expression decreased amount, abnormal WT + MO3-abhd12 standard conditions Fig. 5 from Tingaud-Sequeira et al., 2017
whole organism decreased length, abnormal WT + MO3-abhd12 standard conditions Fig. 4,  Fig. S9 from Tingaud-Sequeira et al., 2017
head decreased length, abnormal WT + MO3-abhd12 standard conditions Fig. S9 from Tingaud-Sequeira et al., 2017
thigmotaxis process quality, abnormal WT + MO3-abhd12 standard conditions Fig. 7 from Tingaud-Sequeira et al., 2017
retinal inner plexiform layer circular, abnormal WT + MO3-abhd12 standard conditions Fig. 8 from Tingaud-Sequeira et al., 2017
retinotectal tract morphology, abnormal WT + MO3-abhd12 standard conditions Fig. 8 from Tingaud-Sequeira et al., 2017
eye photoreceptor cell decreased amount, abnormal WT + MO3-abhd12 standard conditions Fig. 8 from Tingaud-Sequeira et al., 2017
central nervous system myelination disrupted, abnormal WT + MO3-abhd12 standard conditions Fig. 5 from Tingaud-Sequeira et al., 2017
lens opaque, abnormal WT + MO3-abhd12 standard conditions Fig. 8 from Tingaud-Sequeira et al., 2017
posterior lateral line nerve myelinating Schwann cell mbpa expression decreased amount, abnormal WT + MO3-abhd12 standard conditions Fig. 5 from Tingaud-Sequeira et al., 2017
swimming behavior process quality, abnormal WT + MO3-abhd12 standard conditions Fig. 7 from Tingaud-Sequeira et al., 2017
eye decreased size, abnormal WT + MO3-abhd12 standard conditions Fig. 4,  Fig. S9 from Tingaud-Sequeira et al., 2017
anterior lateral line neuromast decreased amount, abnormal s356tTg + MO3-abhd12 standard conditions Fig. 6 from Tingaud-Sequeira et al., 2017
posterior lateral line neuromast decreased amount, abnormal s356tTg + MO3-abhd12 standard conditions Fig. 6 from Tingaud-Sequeira et al., 2017
posterior lateral line neuromast GFP expression decreased amount, abnormal s356tTg + MO3-abhd12 standard conditions Fig. 6 from Tingaud-Sequeira et al., 2017
anterior lateral line neuromast GFP expression decreased amount, abnormal s356tTg + MO3-abhd12 standard conditions Fig. 6 from Tingaud-Sequeira et al., 2017
central nervous system glial cell EGFP expression absent, abnormal ue2Tg + MO3-abhd12 standard conditions Fig. 5 from Tingaud-Sequeira et al., 2017
glial cell myelination disrupted, abnormal ue2Tg + MO3-abhd12 standard conditions Fig. 5,  Fig. S11 from Tingaud-Sequeira et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.