Morpholino

MO1-rbpms

ID

ZDB-MRPHLNO-170306-16

Name

MO1-rbpms

Previous Names

None

Target

rbpms (1)

Sequence

5' - GTGTTGTTCATTCTGGAGCTGAAAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 7

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rbpms

Expressed Gene	Anatomy	Figures
hbbe3	intermediate cell mass of mesoderm nucleate erythrocyte	Fig. 3 from van Rooij et al., 2017

1 - 1 of 1

Phenotype

Phenotype resulting from MO1-rbpms

Phenotype	Fish	Figures
erythrocyte differentiation disrupted, abnormal	WT + MO1-rbpms	Fig. 3 from van Rooij et al., 2017
intermediate cell mass of mesoderm nucleate erythrocyte hbbe3 expression decreased amount, abnormal	WT + MO1-rbpms	Fig. 3 from van Rooij et al., 2017
nucleate erythrocyte decreased amount, abnormal	WT + MO1-rbpms	Fig. 3 from van Rooij et al., 2017

1 - 3 of 3

Phenotype of all Fish created by or utilizing MO1-rbpms

Phenotype	Fish	Conditions	Figures
nucleate erythrocyte decreased amount, abnormal	WT + MO1-rbpms	standard conditions	Fig. 3 from van Rooij et al., 2017
erythrocyte differentiation disrupted, abnormal	WT + MO1-rbpms	standard conditions	Fig. 3 from van Rooij et al., 2017
intermediate cell mass of mesoderm nucleate erythrocyte hbbe3 expression decreased amount, abnormal	WT + MO1-rbpms	standard conditions	Fig. 3 from van Rooij et al., 2017

1 - 3 of 3

Citations

Include unpublished citations

van Rooij, F.J., Qayyum, R., Smith, A.V., Zhou, Y., Trompet, S., Tanaka, T., Keller, M.F., Chang, L.C., Schmidt, H., Yang, M.L., Chen, M.H., Hayes, J., Johnson, A.D., Yanek, L.R., Mueller, C., Lange, L., Floyd, J.S., Ghanbari, M., Zonderman, A.B., Jukema, J.W., Hofman, A., van Duijn, C.M., Desch, K.C., Saba, Y., Ozel, A.B., Snively, B.M., Wu, J.Y., Schmidt, R., Fornage, M., Klein, R.J., Fox, C.S., Matsuda, K., Kamatani, N., Wild, P.S., Stott, D.J., Ford, I., Slagboom, P.E., Yang, J., Chu, A.Y., Lambert, A.J., Uitterlinden, A.G., Franco, O.H., Hofer, E., Ginsburg, D., Hu, B., Keating, B., Schick, U.M., Brody, J.A., Li, J.Z., Chen, Z., Zeller, T., Guralnik, J.M., Chasman, D.I., Peters, L.L., Kubo, M., Becker, D.M., Li, J., Eiriksdottir, G., Rotter, J.I., Levy, D., Grossmann, V., Patel, K.V., Chen, C.H., Ridker, P.M., Tang, H., Launer, L.J., Rice, K.M., Li-Gao, R., Ferrucci, L., Evans, M.K., Choudhuri, A., Trompouki, E., Abraham, B.J., Yang, S., Takahashi, A., Kamatani, Y., Kooperberg, C., Harris, T.B., Jee, S.H., Coresh, J., Tsai, F.J., Longo, D.L., Chen, Y.T., Felix, J.F., Yang, Q., Psaty, B.M., Boerwinkle, E., Becker, L.C., Mook-Kanamori, D.O., Wilson, J.G., Gudnason, V., O'Donnell, C.J., Dehghan, A., Cupples, L.A., Nalls, M.A., Morris, A.P., Okada, Y., Reiner, A.P., Zon, L.I., Ganesh, S.K. (2017) Genome-wide Trans-ethnic Meta-analysis Identifies Seven Genetic Loci Influencing Erythrocyte Traits and a Role for RBPMS in Erythropoiesis. American journal of human genetics. 100(1):51-63

1 - 1 of 1

Show