Morpholino

MO2-dzank1

ID
ZDB-MRPHLNO-170227-6
Name
MO2-dzank1
Previous Names
  • exon8 splice-blocking (1)
Target
Sequence
5' - AGGACATCTTTAGAATGATAGACGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dzank1
Expressed Gene Anatomy Figures
ush2a Fig. 6 with image from Dona et al., 2015
Phenotype
Phenotype resulting from MO2-dzank1
Phenotype Fish Figures
eye decreased size, abnormal TL + MO2-dzank1 Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell ush2a expression decreased distribution, abnormal TL + MO2-dzank1 Fig. 6 with image from Dona et al., 2015
eye photoreceptor cell Ab2-ninl labeling decreased distribution, abnormal TL + MO2-dzank1 Fig. 6 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor outer segment, abnormal TL + MO2-dzank1 Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell vacuolated, abnormal TL + MO2-dzank1 Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell cell body ab5-rho labeling mislocalised, abnormal TL + MO2-dzank1 Fig. S9 with image from Dona et al., 2015
eye photoreceptor cell Golgi apparatus swollen, abnormal TL + MO2-dzank1 Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell Golgi stack distended, abnormal TL + MO2-dzank1 Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor disc membrane deformed, abnormal TL + MO2-dzank1 Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vacuole, abnormal TL + MO2-dzank1 Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vesicle, abnormal TL + MO2-dzank1 Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment has extra parts of type eye photoreceptor cell lysosome, abnormal TL + MO2-dzank1 Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment malformed, abnormal TL + MO2-dzank1 Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO2-dzank1 Fig. 3 with image,  Fig. 4 with image,  Fig. S1 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment has extra parts of type eye photoreceptor cell vesicle, abnormal TL + MO2-dzank1 Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment morphology, abnormal TL + MO2-dzank1 Fig. 3 with image from Dona et al., 2015
optokinetic behavior decreased process quality, abnormal TL + MO2-dzank1 Fig. 3 with image from Dona et al., 2015
pericardium edematous, abnormal TL + MO2-dzank1 Fig. 3 with image from Dona et al., 2015
swimming disrupted, abnormal TL + MO2-dzank1 Fig. S1 with image from Dona et al., 2015
Phenotype of all Fish created by or utilizing MO2-dzank1
Phenotype Fish Conditions Figures
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO2-dzank1 control Fig. 3 with image,  Fig. 4 with image,  Fig. S1 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment malformed, abnormal TL + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell ush2a expression decreased distribution, abnormal TL + MO2-dzank1 control Fig. 6 with image from Dona et al., 2015
eye photoreceptor cell Golgi apparatus swollen, abnormal TL + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell vacuolated, abnormal TL + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
swimming disrupted, abnormal TL + MO2-dzank1 control Fig. S1 with image from Dona et al., 2015
optokinetic behavior decreased process quality, abnormal TL + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor disc membrane deformed, abnormal TL + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vacuole, abnormal TL + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment has extra parts of type eye photoreceptor cell lysosome, abnormal TL + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell cell body ab5-rho labeling mislocalised, abnormal TL + MO2-dzank1 control Fig. S9 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment has extra parts of type eye photoreceptor cell vesicle, abnormal TL + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment morphology, abnormal TL + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye decreased size, abnormal TL + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell Golgi stack distended, abnormal TL + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
pericardium edematous, abnormal TL + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell Ab2-ninl labeling decreased distribution, abnormal TL + MO2-dzank1 control Fig. 6 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor outer segment, abnormal TL + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vesicle, abnormal TL + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell vacuolated, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment has extra parts of type eye photoreceptor cell vesicle, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell Golgi apparatus swollen, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment has extra parts of type eye photoreceptor cell lysosome, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
swimming disrupted, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor inner segment, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor disc membrane deformed, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor outer segment, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment has extra parts of type eye photoreceptor cell vesicle, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
whole organism anterior-posterior axis curved ventral, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment morphology, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
photoreceptor cell outer segment organization disrupted, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
pericardium edematous, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
post-vent region increased curvature, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vesicle, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image,  Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell Golgi stack distended, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.