Morpholino
MO1-ninl
- ID
- ZDB-MRPHLNO-170227-3
- Name
- MO1-ninl
- Previous Names
- None
- Target
- Sequence
-
5' - CATCCTCGTCCATCCCACCACATAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ninl
No data available
Phenotype
Phenotype resulting from MO1-ninl
1 - 5 of 30 Show all
Phenotype of all Fish created by or utilizing MO1-ninl
1 - 5 of 60 Show all
Citations
- Bachmann-Gagescu, R., Dona, M., Hetterschijt, L., Tonnaer, E., Peters, T., de Vrieze, E., Mans, D.A., van Beersum, S.E., Phelps, I.G., Arts, H.H., Keunen, J.E., Ueffing, M., Roepman, R., Boldt, K., Doherty, D., Moens, C.B., Neuhauss, S.C., Kremer, H., van Wijk, E. (2015) The Ciliopathy Protein CC2D2A Associates with NINL and Functions in RAB8-MICAL3-Regulated Vesicle Trafficking. PLoS Genetics. 11:e1005575
- Dona, M., Bachmann-Gagescu, R., Texier, Y., Toedt, G., Hetterschijt, L., Tonnaer, E.L., Peters, T.A., van Beersum, S.E., Bergboer, J.G., Horn, N., de Vrieze, E., Slijkerman, R.W., van Reeuwijk, J., Flik, G., Keunen, J.E., Ueffing, M., Gibson, T.J., Roepman, R., Boldt, K., Kremer, H., van Wijk, E. (2015) NINL and DZANK1 Co-function in Vesicle Transport and Are Essential for Photoreceptor Development in Zebrafish. PLoS Genetics. 11:e1005574
1 - 2 of 2
Show