Morpholino
MO8-chd7
- ID
- ZDB-MRPHLNO-170208-2
- Name
- MO8-chd7
- Previous Names
- None
- Target
- Sequence
-
5' - ATGGAGGGTCAATTCTAACCTCAGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO8-chd7
Expressed Gene | Anatomy | Figures |
---|---|---|
crestin |
Fig. 5,
Fig. S5
from Asad et al., 2016 |
|
dct |
Fig. 4
from Asad et al., 2016 |
|
dlx2a |
Fig. 7
from Asad et al., 2016 |
|
egr2b |
Fig. S6
from Asad et al., 2016 |
|
foxd3 | (all 7) |
Fig. 2,
Fig. 6
from Asad et al., 2016 |
1 - 5 of 16 Show all
Phenotype
Phenotype resulting from MO8-chd7
1 - 5 of 58 Show all
Phenotype of all Fish created by or utilizing MO8-chd7
1 - 5 of 124 Show all
Citations
- Asad, Z., Sachidanandan, C. (2019) Chemical screens in a zebrafish model of CHARGE syndrome identifies small molecules that ameliorates disease like phenotypes in embryo. European Journal of Medical Genetics. 63(2):103661
- Asad, Z., Pandey, A., Babu, A., Sun, Y., Shevade, K., Kapoor, S., Ullah, I., Ranjan, S., Scaria, V., Bajpai, R., Sachidanandan, C. (2016) Rescue of neural crest derived phenotypes in a zebrafish CHARGE model by sox10 downregulation. Human molecular genetics. 25(16):3539-3554
1 - 2 of 2
Show