ZFIN ID: ZDB-MRPHLNO-170127-23
Morpholino Name: MO6-pax2a
Target: pax2a (1)
Sequence:
5' - ATGTGCTTTTTCTTACCTTCCGAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-pax2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-pax2a No data available
PHENOTYPE
Phenotype resulting from MO6-pax2a
Phenotype Figures
brain hydrocephalic, abnormal Fig. S1 from Shim et al., 2016
heart edematous, abnormal Fig. S1 from Shim et al., 2016
otolith malformed, abnormal Fig. S1 from Shim et al., 2016
post-vent region curved, abnormal Fig. S1 from Shim et al., 2016

Phenotype of all Fish created by or utilizing MO6-pax2a
Phenotype Fish Conditions Figures
otolith malformed, abnormal WT + MO6-pax2a standard conditions Fig. S1 from Shim et al., 2016
heart edematous, abnormal WT + MO6-pax2a standard conditions Fig. S1 from Shim et al., 2016
post-vent region curved, abnormal WT + MO6-pax2a standard conditions Fig. S1 from Shim et al., 2016
brain hydrocephalic, abnormal WT + MO6-pax2a standard conditions Fig. S1 from Shim et al., 2016
OTHER MO6-pax2a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)