Morpholino

MO2-mtch2

ID

ZDB-MRPHLNO-170109-4

Name

MO2-mtch2

Previous Names

Target

Sequence

5' - TGTCCGACCTATTTACAAAGATACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-mtch2

No data available

Phenotype

Phenotype resulting from MO2-mtch2

Phenotype	Fish	Figures
digestive tract development disrupted, abnormal	AB + MO2-mtch2	Fig. 3 from Landgraf et al., 2016
eye decreased size, abnormal	AB + MO2-mtch2	Fig. 4 from Landgraf et al., 2016
fat cell differentiation disrupted, abnormal	AB + MO2-mtch2	Fig. 4 from Landgraf et al., 2016
intestine fabp2 expression decreased distribution, abnormal	AB + MO2-mtch2	Fig. 3 from Landgraf et al., 2016
liver fabp10a expression decreased distribution, abnormal	AB + MO2-mtch2	Fig. 3 from Landgraf et al., 2016
liver development disrupted, abnormal	AB + MO2-mtch2	Fig. 3 from Landgraf et al., 2016
visceral fat fat cell decreased amount, abnormal	AB + MO2-mtch2	Fig. 4 from Landgraf et al., 2016
whole organism fabp10a expression decreased amount, abnormal	AB + MO2-mtch2	Fig. 3 from Landgraf et al., 2016
whole organism mtch2 expression decreased amount, abnormal	AB + MO2-mtch2	Fig. 2 from Landgraf et al., 2016

Phenotype of all Fish created by or utilizing MO2-mtch2

Phenotype	Fish	Conditions	Figures
fat cell differentiation disrupted, abnormal	AB + MO2-mtch2	standard conditions	Fig. 4 from Landgraf et al., 2016
liver fabp10a expression decreased distribution, abnormal	AB + MO2-mtch2	standard conditions	Fig. 3 from Landgraf et al., 2016
intestine fabp2 expression decreased distribution, abnormal	AB + MO2-mtch2	standard conditions	Fig. 3 from Landgraf et al., 2016
visceral fat fat cell decreased amount, abnormal	AB + MO2-mtch2	standard conditions	Fig. 4 from Landgraf et al., 2016
eye decreased size, abnormal	AB + MO2-mtch2	standard conditions	Fig. 4 from Landgraf et al., 2016
digestive tract development disrupted, abnormal	AB + MO2-mtch2	standard conditions	Fig. 3 from Landgraf et al., 2016
whole organism fabp10a expression decreased amount, abnormal	AB + MO2-mtch2	standard conditions	Fig. 3 from Landgraf et al., 2016
whole organism mtch2 expression decreased amount, abnormal	AB + MO2-mtch2	standard conditions	Fig. 2 from Landgraf et al., 2016
liver development disrupted, abnormal	AB + MO2-mtch2	standard conditions	Fig. 3 from Landgraf et al., 2016

Citations