Morpholino

MO1-kcnk1b

ID

ZDB-MRPHLNO-161107-2

Name

MO1-kcnk1b

Previous Names

E1I1- MO (1)

Target

kcnk1b (1)

Sequence

5' - CTAGCTCACTCACTCACCTGTGGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-kcnk1b

No data available

Phenotype

Phenotype resulting from MO1-kcnk1b

Phenotype	Fish	Figures
atrium dilated, abnormal	twu34Tg + MO1-kcnk1b	Fig. 1, Fig. S1 from Christensen et al., 2016
heart elongated, abnormal	twu34Tg + MO1-kcnk1b	Fig. S1 from Christensen et al., 2016
heart increased size, abnormal	twu34Tg + MO1-kcnk1b	Fig. S1 from Christensen et al., 2016
heart contraction decreased rate, abnormal	twu34Tg + MO1-kcnk1b	Fig. 1, Fig. S1 from Christensen et al., 2016
post-vent region decreased length, abnormal	twu34Tg + MO1-kcnk1b	Fig. S1 from Christensen et al., 2016
post-vent region increased curvature, abnormal	twu34Tg + MO1-kcnk1b	Fig. S1 from Christensen et al., 2016

Phenotype of all Fish created by or utilizing MO1-kcnk1b

Phenotype	Fish	Conditions	Figures
heart increased size, abnormal	twu34Tg + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016
atrium dilated, abnormal	twu34Tg + MO1-kcnk1b	standard conditions	Fig. 1, Fig. S1 from Christensen et al., 2016
heart elongated, abnormal	twu34Tg + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016
post-vent region decreased length, abnormal	twu34Tg + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016
heart contraction decreased rate, abnormal	twu34Tg + MO1-kcnk1b	standard conditions	Fig. 1, Fig. S1 from Christensen et al., 2016
post-vent region increased curvature, abnormal	twu34Tg + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016
atrium dilated, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. 1, Fig. S1 from Christensen et al., 2016
heart increased size, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016
heart elongated, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016
cardiac ventricle dilated, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. 1, Fig. S1 from Christensen et al., 2016
post-vent region decreased length, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016
heart contraction decreased rate, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. 1, Fig. S1 from Christensen et al., 2016
pericardium edematous, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016
post-vent region increased curvature, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016

Citations