Morpholino
MO3-nphp1
- ID
- ZDB-MRPHLNO-161012-9
- Name
- MO3-nphp1
- Previous Names
- None
- Target
- Sequence
-
5' - ACAGATACAAGTCCTCTACCTCTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nphp1
No data available
Phenotype
Phenotype resulting from MO3-nphp1
No data available
Phenotype of all Fish created by or utilizing MO3-nphp1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| proximal straight tubule increased diameter, abnormal | WT + MO1-ncapg2 + MO3-nphp1 | standard conditions |
Fig. 5
from Khan et al., 2019 |
1 - 1 of 1
Citations
- Khan, T.N., Khan, K., Sadeghpour, A., Reynolds, H., Perilla, Y., McDonald, M.T., Gallentine, W.B., Baig, S.M., Task Force for Neonatal Genomics, Davis, E.E., Katsanis, N. (2019) Mutations in NCAPG2 Cause a Severe Neurodevelopmental Syndrome that Expands the Phenotypic Spectrum of Condensinopathies. American journal of human genetics. 104:94-111
- Lindstrand, A., Frangakis, S., Carvalho, C.M., Richardson, E.B., McFadden, K.A., Willer, J.R., Pehlivan, D., Liu, P., Pediaditakis, I.L., Sabo, A., Lewis, R.A., Banin, E., Lupski, J.R., Davis, E.E., Katsanis, N. (2016) Copy-Number Variation Contributes to the Mutational Load of Bardet-Biedl Syndrome. American journal of human genetics. 99:318-336
1 - 2 of 2
Show