Morpholino

MO2-prrx1a

ID
ZDB-MRPHLNO-161010-3
Name
MO2-prrx1a
Previous Names
None
Target
Sequence
5' - TTTTGTTCTCCAGCACTTACTCTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-prrx1a
No data available
Phenotype
Phenotype resulting from MO2-prrx1a
Phenotype Fish Figures
atrial cardiac muscle cell action potential decreased duration, abnormal AB/TU + MO2-prrx1a Fig. S2 from Tucker et al., 2017
atrial cardiac muscle cell action potential process quality, abnormal AB/TU + MO2-prrx1a Fig. S2 from Tucker et al., 2017
atrium decreased size, abnormal in2Tg + MO2-prrx1a Fig. 1 from Ocaña et al., 2017
cell migration involved in heart development process quality, abnormal in2Tg + MO2-prrx1a Fig. 2 from Ocaña et al., 2017
determination of heart left/right asymmetry disrupted, abnormal AB + MO2-prrx1a Fig. 2 from Tessadori et al., 2020
Fig. 1 from Ocaña et al., 2017
heart linear, abnormal AB + MO2-prrx1a Fig. 1 from Ocaña et al., 2017
heart morphology, abnormal prrx1ael558/el558 + MO2-prrx1a Fig. 2 from Tessadori et al., 2020
heart development disrupted, abnormal in2Tg + MO2-prrx1a Fig. 2 from Ocaña et al., 2017
heart jogging process quality, abnormal AB + MO2-prrx1a Fig. S5 from Ocaña et al., 2017
heart looping disrupted, abnormal AB + MO2-prrx1a Fig. 2 from Tessadori et al., 2020
Fig. 1Fig. S2 from Ocaña et al., 2017
heart tube position, abnormal AB + MO2-prrx1a Fig. S5 from Ocaña et al., 2017
Kupffer's vesicle cilium decreased amount, abnormal WT + MO2-prrx1a Fig. 2 from Tessadori et al., 2020
lateral plate mesoderm twist1b expression decreased distribution, abnormal WT + MO2-prrx1a Fig. 3 with image from Ocaña et al., 2012
lateral plate mesoderm cell migration decreased occurrence, abnormal WT + MO2-prrx1a Fig. 3 with image from Ocaña et al., 2012
lateral plate mesoderm right side pitx2 expression mislocalised, abnormal AB + MO2-prrx1a Fig. 5 from Ocaña et al., 2017
sinus venosus absent, abnormal AB + MO2-prrx1a Fig. 1Fig. S2 from Ocaña et al., 2017
sinus venosus ab1-isl labeling absent, abnormal in2Tg + MO2-prrx1a Fig. 1 from Ocaña et al., 2017
Phenotype of all Fish created by or utilizing MO2-prrx1a
Phenotype Fish Conditions Figures
heart looping disrupted, abnormal prrx1ael558/el558 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart morphology, abnormal prrx1ael558/el558 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
determination of heart left/right asymmetry disrupted, abnormal prrx1ael558/el558 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart morphology, abnormal prrx1ahu13685/hu13685 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart looping disrupted, abnormal prrx1ahu13685/hu13685 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
sinus venosus absent, abnormal AB + MO2-prrx1a standard conditions Fig. S2 from Ocaña et al., 2017
heart linear, abnormal AB + MO2-prrx1a standard conditions Fig. 1 from Ocaña et al., 2017
atrium decreased size, abnormal AB + MO2-prrx1a standard conditions Fig. 1 from Ocaña et al., 2017
lateral plate mesoderm right side pitx2 expression mislocalised, abnormal AB + MO2-prrx1a standard conditions Fig. 5 from Ocaña et al., 2017
heart tube position, abnormal AB + MO2-prrx1a standard conditions Fig. S5 from Ocaña et al., 2017
heart jogging process quality, abnormal AB + MO2-prrx1a standard conditions Fig. S5 from Ocaña et al., 2017
determination of heart left/right asymmetry disrupted, abnormal AB + MO2-prrx1a standard conditions Fig. 1 from Ocaña et al., 2017
heart looping disrupted, abnormal AB + MO2-prrx1a standard conditions Fig. 1Fig. S2 from Ocaña et al., 2017
atrial cardiac muscle cell action potential decreased duration, abnormal AB/TU + MO2-prrx1a standard conditions Fig. S2 from Tucker et al., 2017
atrial cardiac muscle cell action potential process quality, abnormal AB/TU + MO2-prrx1a standard conditions Fig. S2 from Tucker et al., 2017
heart morphology, abnormal WT + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
lateral plate mesoderm cell migration decreased occurrence, abnormal WT + MO2-prrx1a standard conditions Fig. 3 with image from Ocaña et al., 2012
determination of heart left/right asymmetry disrupted, abnormal WT + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart looping disrupted, abnormal WT + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
lateral plate mesoderm twist1b expression decreased distribution, abnormal WT + MO2-prrx1a standard conditions Fig. 3 with image from Ocaña et al., 2012
Kupffer's vesicle cilium decreased amount, abnormal WT + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
sinus venosus absent, abnormal in2Tg + MO2-prrx1a standard conditions Fig. 1 from Ocaña et al., 2017
sinus venosus ab1-isl labeling absent, abnormal in2Tg + MO2-prrx1a standard conditions Fig. 1 from Ocaña et al., 2017
atrium decreased size, abnormal in2Tg + MO2-prrx1a standard conditions Fig. 1 from Ocaña et al., 2017
determination of heart left/right asymmetry disrupted, abnormal in2Tg + MO2-prrx1a standard conditions Fig. 1 from Ocaña et al., 2017
cell migration involved in heart development process quality, abnormal in2Tg + MO2-prrx1a standard conditions Fig. 2 from Ocaña et al., 2017
heart looping disrupted, abnormal in2Tg + MO2-prrx1a standard conditions Fig. 1 from Ocaña et al., 2017
heart development disrupted, abnormal in2Tg + MO2-prrx1a standard conditions Fig. 2 from Ocaña et al., 2017
heart linear, abnormal in2Tg + MO2-prrx1a standard conditions Fig. 1 from Ocaña et al., 2017
heart morphology, abnormal prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
determination of heart left/right asymmetry disrupted, abnormal prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart looping disrupted, abnormal prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
determination of heart left/right asymmetry disrupted, abnormal prrx1ael558/el558; prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart morphology, abnormal prrx1ael558/el558; prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart looping disrupted, abnormal prrx1ael558/el558; prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
determination of heart left/right asymmetry disrupted, abnormal prrx1ahu13685/hu13685; prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart morphology, abnormal prrx1ahu13685/hu13685; prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
heart looping disrupted, abnormal prrx1ahu13685/hu13685; prrx1bel491/el491 + MO2-prrx1a standard conditions Fig. 2 from Tessadori et al., 2020
Citations