Morpholino

MO2-map9

ID
ZDB-MRPHLNO-161007-5
Name
MO2-map9
Previous Names
  • MOex5 (1)
Target
Sequence
5' - ACAACCTGTTTACATAAAAAGGTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-map9
Phenotype
Phenotype resulting from MO2-map9
No data available
Phenotype of all Fish created by or utilizing MO2-map9
Phenotype Fish Conditions Figures
pericardium edematous, abnormal + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
somite shape, abnormal + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
eye aplastic, abnormal + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
caudal fin malformed, abnormal + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
brain hypoplastic, abnormal + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
whole organism morphology, abnormal + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
notochord morphology, abnormal + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
yolk morphology, abnormal + MO1-map9 + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
whole organism map9 expression decreased amount, abnormal + MO2-map9 standard conditions Fig. 2 with imageFig. 8 from Fontenille et al., 2014
whole organism plk1 expression increased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
whole organism gsc expression decreased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
mitotic telophase decreased occurrence, abnormal + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
whole organism shha expression decreased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
growth arrested, abnormal + MO2-map9 standard conditions Fig. 2 with image from Fontenille et al., 2014
epiboly arrested, abnormal + MO2-map9 standard conditions Fig. 2 with imageFig. 3 with imageFig. 7 with image from Fontenille et al., 2014
whole organism smo expression decreased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
whole organism dead, abnormal + MO2-map9 standard conditions Fig. 4 with image from Fontenille et al., 2014
whole organism aurka expression increased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
mitotic metaphase plate congression process quality, abnormal + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
mitotic anaphase decreased occurrence, abnormal + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
cell metaphase plate morphology, abnormal + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
yolk syncytial layer spindle absent, abnormal + MO2-map9 standard conditions Fig. 6 with image from Fontenille et al., 2014
whole organism eomesb expression decreased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
cell spindle shape, abnormal + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
whole organism plk4 expression increased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
whole organism tdgf1 expression increased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
whole organism sebox expression decreased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
mitotic cell cycle decreased occurrence, abnormal + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
spindle assembly process quality, abnormal + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
whole organism eomesa expression increased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
cell chromosome morphology, abnormal + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
yolk microtubule cytoskeleton morphology, abnormal + MO2-map9 standard conditions Fig. 6 with image from Fontenille et al., 2014
mitotic prophase decreased occurrence, abnormal + MO2-map9 standard conditions Fig. 5 with image from Fontenille et al., 2014
whole organism lft1 expression increased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
apoptotic process increased occurrence, abnormal + MO2-map9 standard conditions Fig. 4 with image from Fontenille et al., 2014
margin sox17 expression decreased distribution, abnormal + MO2-map9 standard conditions Fig. 9 with image from Fontenille et al., 2014
whole organism foxa2 expression decreased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
margin sox32 expression decreased distribution, abnormal + MO2-map9 standard conditions Fig. 9 with image from Fontenille et al., 2014
whole organism sox32 expression decreased amount, abnormal + MO2-map9 standard conditions Fig. 8 from Fontenille et al., 2014
whole organism dead, abnormal + MO11-tp53 + MO2-map9 standard conditions Fig. 4 with image from Fontenille et al., 2014
apoptotic process increased occurrence, abnormal + MO11-tp53 + MO2-map9 standard conditions Fig. 4 with image from Fontenille et al., 2014
Citations