Morpholino

MO2-nr2e3

ID

ZDB-MRPHLNO-161003-2

Name

MO2-nr2e3

Previous Names

Target

Sequence

5' - ATACGCAAGTTGTTTTCTCACCTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-nr2e3

No data available

Phenotype

Phenotype resulting from MO2-nr2e3

Phenotype	Fish	Figures
parapineal organ has extra parts of type parapineal organ neuron, abnormal	sqet11Et + MO2-nr2e3	Fig. 6 , Fig. 7 from Khuansuwan et al., 2016
parapineal organ neuron fate specification increased occurrence, abnormal	sqet11Et + MO2-nr2e3	Fig. 6 , Fig. 7 from Khuansuwan et al., 2016
pineal complex nr2e3 expression decreased amount, abnormal	sqet11Et + MO2-nr2e3	Fig. 6 from Khuansuwan et al., 2016
pineal complex has fewer parts of type pineal complex photoreceptor cell, abnormal	sqet11Et + MO2-nr2e3	Fig. 6 from Khuansuwan et al., 2016
pineal complex photoreceptor cell fate specification decreased occurrence, abnormal	sqet11Et + MO2-nr2e3	Fig. 6 from Khuansuwan et al., 2016

Phenotype of all Fish created by or utilizing MO2-nr2e3

Phenotype	Fish	Conditions	Figures
parapineal organ has extra parts of type parapineal organ neuron, abnormal	sqet11Et + MO2-nr2e3	standard conditions	Fig. 6 , Fig. 7 from Khuansuwan et al., 2016
pineal complex photoreceptor cell fate specification decreased occurrence, abnormal	sqet11Et + MO2-nr2e3	standard conditions	Fig. 6 from Khuansuwan et al., 2016
pineal complex has fewer parts of type pineal complex photoreceptor cell, abnormal	sqet11Et + MO2-nr2e3	standard conditions	Fig. 6 from Khuansuwan et al., 2016
pineal complex nr2e3 expression decreased amount, abnormal	sqet11Et + MO2-nr2e3	standard conditions	Fig. 6 from Khuansuwan et al., 2016
parapineal organ neuron fate specification increased occurrence, abnormal	sqet11Et + MO2-nr2e3	standard conditions	Fig. 6 , Fig. 7 from Khuansuwan et al., 2016
parapineal organ has extra parts of type parapineal organ neuron, abnormal	noto^n1/+; sqet11Et + MO2-nr2e3	standard conditions	Fig. 7 from Khuansuwan et al., 2016
parapineal organ neuron fate specification increased occurrence, abnormal	noto^n1/+; sqet11Et + MO2-nr2e3	standard conditions	Fig. 7 from Khuansuwan et al., 2016
parapineal organ has extra parts of type parapineal organ neuron, abnormal	noto^n1/n1; sqet11Et + MO2-nr2e3	standard conditions	Fig. 7 from Khuansuwan et al., 2016
parapineal organ neuron fate specification increased occurrence, abnormal	noto^n1/n1; sqet11Et + MO2-nr2e3	standard conditions	Fig. 7 from Khuansuwan et al., 2016

Citations