Morpholino

MO2-kctd10

ID
ZDB-MRPHLNO-160912-1
Name
MO2-kctd10
Previous Names
None
Target
Sequence
5' - CACTTTCTCCTGACATCTCTTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-kctd10
Expressed Gene Anatomy Figures
kdrl Fig. 8 from Hu et al., 2014
myh6 Fig. 7 from Hu et al., 2014
myh7 Fig. 7 from Hu et al., 2014
myl7 Fig. 7 from Hu et al., 2014
Phenotype
Phenotype resulting from MO2-kctd10
Phenotype Fish Figures
caudal fin kinked, abnormal WT + MO2-kctd10 Fig. 5,  Fig. 6 from Hu et al., 2014
embryonic heart tube left/right pattern formation decreased occurrence, abnormal WT + MO2-kctd10 Fig. 7 from Hu et al., 2014
head decreased size, abnormal WT + MO2-kctd10 Fig. 5,  Fig. 6 from Hu et al., 2014
heart morphology, abnormal WT + MO2-kctd10 Fig. 7 from Hu et al., 2014
heart tubular, abnormal WT + MO2-kctd10 Fig. 5,  Fig. 7 from Hu et al., 2014
heart looping decreased occurrence, abnormal WT + MO2-kctd10 Fig. 5,  Fig. 7 from Hu et al., 2014
intersegmental vessel kdrl expression absent, abnormal WT + MO2-kctd10 Fig. 8 from Hu et al., 2014
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal WT + MO2-kctd10 Fig. 8 from Hu et al., 2014
pericardium edematous, abnormal WT + MO2-kctd10 Fig. 5,  Fig. 6 from Hu et al., 2014
somite morphology, abnormal WT + MO2-kctd10 Fig. 5 from Hu et al., 2014
trunk curved, abnormal WT + MO2-kctd10 Fig. 5 from Hu et al., 2014
trunk decreased size, abnormal WT + MO2-kctd10 Fig. 5 from Hu et al., 2014
whole organism ab2-pcna labeling increased amount, abnormal WT + MO2-kctd10 Fig. 9 from Hu et al., 2014
whole organism morphology, abnormal WT + MO2-kctd10 Fig. 5 from Hu et al., 2014
Phenotype of all Fish created by or utilizing MO2-kctd10
Phenotype Fish Conditions Figures
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal WT + MO2-kctd10 control Fig. 8 from Hu et al., 2014
embryonic heart tube left/right pattern formation decreased occurrence, abnormal WT + MO2-kctd10 control Fig. 7 from Hu et al., 2014
caudal fin kinked, abnormal WT + MO2-kctd10 standard conditions Fig. 5,  Fig. 6 from Hu et al., 2014
somite morphology, abnormal WT + MO2-kctd10 control Fig. 5 from Hu et al., 2014
intersegmental vessel kdrl expression absent, abnormal WT + MO2-kctd10 control Fig. 8 from Hu et al., 2014
heart looping decreased occurrence, abnormal WT + MO2-kctd10 control Fig. 5,  Fig. 7 from Hu et al., 2014
head decreased size, abnormal WT + MO2-kctd10 standard conditions Fig. 5,  Fig. 6 from Hu et al., 2014
pericardium edematous, abnormal WT + MO2-kctd10 standard conditions Fig. 5,  Fig. 6 from Hu et al., 2014
whole organism morphology, abnormal WT + MO2-kctd10 control Fig. 5 from Hu et al., 2014
whole organism ab2-pcna labeling increased amount, abnormal WT + MO2-kctd10 control Fig. 9 from Hu et al., 2014
trunk decreased size, abnormal WT + MO2-kctd10 control Fig. 5 from Hu et al., 2014
heart tubular, abnormal WT + MO2-kctd10 control Fig. 5,  Fig. 7 from Hu et al., 2014
heart morphology, abnormal WT + MO2-kctd10 control Fig. 7 from Hu et al., 2014
trunk curved, abnormal WT + MO2-kctd10 control Fig. 5 from Hu et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.