ZFIN ID: ZDB-MRPHLNO-160809-6
Morpholino Name: MO4-mybpc1
Target: mybpc1 (1)
Sequence:
5' - TGTACCACTCCTGTAACAAACACAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-mybpc1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-mybpc1
Expressed Gene Anatomy Figures
map1lc3b Fig. 4 from Li et al., 2016
mybpc1 Fig. 2 from Li et al., 2016
myog Fig. 4 from Li et al., 2016
sqstm1 Fig. 4 from Li et al., 2016
trim54 Fig. 4 from Li et al., 2016
trim55a Fig. 4 from Li et al., 2016
trim63a Fig. 4 from Li et al., 2016
PHENOTYPE
Phenotype resulting from MO4-mybpc1
Phenotype Figures
trunk skeletal muscle sqstm1 expression increased amount, abnormal Fig. 4 from Li et al., 2016

Phenotype of all Fish created by or utilizing MO4-mybpc1
Phenotype Fish Conditions Figures
trunk skeletal muscle sqstm1 expression increased amount, abnormal TU + MO4-mybpc1 standard conditions Fig. 4 from Li et al., 2016
OTHER MO4-mybpc1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)