Morpholino

MO1-polr1c

ID
ZDB-MRPHLNO-160719-1
Name
MO1-polr1c
Previous Names
  • intron1 and exon2 (1)
Target
Sequence
5' - TGGACCTGTAAATATTAGATACAGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-polr1c
Expressed Gene Anatomy Figures
capn3a Fig. 7 from Lau et al., 2016
col2a1a Fig. 6 from Lau et al., 2016
dlx2a Fig. 5 from Lau et al., 2016
fmn1 Fig. 7 from Lau et al., 2016
sox9a Fig. 6 from Lau et al., 2016
ttr Fig. 7 from Lau et al., 2016
Phenotype
Phenotype resulting from MO1-polr1c
Phenotype Fish Figures
ethmoid cartilage sox9a expression decreased amount, abnormal AB + MO1-polr1c Fig. 6 from Lau et al., 2016
ethmoid cartilage col2a1a expression decreased amount, abnormal AB + MO1-polr1c Fig. 6 from Lau et al., 2016
ethmoid cartilage hypoplastic, abnormal AB + MO1-polr1c Fig. 3 from Lau et al., 2016
eye decreased size, abnormal AB + MO1-polr1c Fig. 3,  Fig. 8 from Lau et al., 2016
head morphology, abnormal AB + MO1-polr1c Fig. 3,  Fig. 8 from Lau et al., 2016
mandibular arch skeleton agenesis, abnormal AB + MO1-polr1c Fig. 3,  Fig. 8 from Lau et al., 2016
neural crest cell fate specification disrupted, abnormal AB + MO1-polr1c Fig. 5,  Fig. 6 from Lau et al., 2016
palate morphology, abnormal AB + MO1-polr1c Fig. 3 from Lau et al., 2016
pharyngeal arch apoptotic, abnormal AB + MO1-polr1c Fig. 4 from Lau et al., 2016
pharyngeal arch col2a1a expression decreased amount, abnormal AB + MO1-polr1c Fig. 6 from Lau et al., 2016
pharyngeal arch dlx2a expression decreased amount, abnormal AB + MO1-polr1c Fig. 5 from Lau et al., 2016
pharyngeal arch EGFP expression decreased amount, abnormal y1Tg + MO1-polr1c Fig. 5,  Fig. 6 from Lau et al., 2016
pharyngeal arch sox9a expression decreased amount, abnormal AB + MO1-polr1c Fig. 6 from Lau et al., 2016
pharyngeal arch cartilage absent, abnormal AB + MO1-polr1c Fig. 3 from Lau et al., 2016
rRNA transcription disrupted, abnormal AB + MO1-polr1c Fig. 4 from Lau et al., 2016
ventral mandibular arch apoptotic, abnormal AB + MO1-polr1c Fig. 4 from Lau et al., 2016
whole organism capn3a expression decreased amount, abnormal AB + MO1-polr1c Fig. 7 from Lau et al., 2016
whole organism ttr expression decreased amount, abnormal AB + MO1-polr1c Fig. 7 from Lau et al., 2016
whole organism fmn1 expression decreased amount, abnormal AB + MO1-polr1c Fig. 7 from Lau et al., 2016
Phenotype of all Fish created by or utilizing MO1-polr1c
Phenotype Fish Conditions Figures
pharyngeal arch col2a1a expression decreased amount, abnormal AB + MO1-polr1c standard conditions Fig. 6 from Lau et al., 2016
eye decreased size, abnormal AB + MO1-polr1c standard conditions Fig. 3,  Fig. 8 from Lau et al., 2016
head morphology, abnormal AB + MO1-polr1c standard conditions Fig. 3,  Fig. 8 from Lau et al., 2016
rRNA transcription disrupted, abnormal AB + MO1-polr1c standard conditions Fig. 4 from Lau et al., 2016
whole organism capn3a expression decreased amount, abnormal AB + MO1-polr1c standard conditions Fig. 7 from Lau et al., 2016
whole organism ttr expression decreased amount, abnormal AB + MO1-polr1c standard conditions Fig. 7 from Lau et al., 2016
neural crest cell fate specification disrupted, abnormal AB + MO1-polr1c standard conditions Fig. 5,  Fig. 6 from Lau et al., 2016
pharyngeal arch dlx2a expression decreased amount, abnormal AB + MO1-polr1c control Fig. 5 from Lau et al., 2016
pharyngeal arch sox9a expression decreased amount, abnormal AB + MO1-polr1c standard conditions Fig. 6 from Lau et al., 2016
pharyngeal arch cartilage absent, abnormal AB + MO1-polr1c standard conditions Fig. 3 from Lau et al., 2016
ethmoid cartilage col2a1a expression decreased amount, abnormal AB + MO1-polr1c standard conditions Fig. 6 from Lau et al., 2016
mandibular arch skeleton agenesis, abnormal AB + MO1-polr1c standard conditions Fig. 3,  Fig. 8 from Lau et al., 2016
ventral mandibular arch apoptotic, abnormal AB + MO1-polr1c standard conditions Fig. 4 from Lau et al., 2016
palate morphology, abnormal AB + MO1-polr1c standard conditions Fig. 3 from Lau et al., 2016
pharyngeal arch apoptotic, abnormal AB + MO1-polr1c standard conditions Fig. 4 from Lau et al., 2016
ethmoid cartilage hypoplastic, abnormal AB + MO1-polr1c standard conditions Fig. 3 from Lau et al., 2016
ethmoid cartilage sox9a expression decreased amount, abnormal AB + MO1-polr1c standard conditions Fig. 6 from Lau et al., 2016
whole organism fmn1 expression decreased amount, abnormal AB + MO1-polr1c standard conditions Fig. 7 from Lau et al., 2016
pharyngeal arch EGFP expression decreased amount, abnormal y1Tg + MO1-polr1c standard conditions Fig. 5,  Fig. 6 from Lau et al., 2016
neural crest cell fate specification disrupted, abnormal y1Tg + MO1-polr1c standard conditions Fig. 5,  Fig. 6 from Lau et al., 2016
eye size, ameliorated tp53zdf1/zdf1 + MO1-polr1c standard conditions Fig. 8 from Lau et al., 2016
mandibular arch skeleton morphology, ameliorated tp53zdf1/zdf1 + MO1-polr1c standard conditions Fig. 8 from Lau et al., 2016
head morphology, ameliorated tp53zdf1/zdf1 + MO1-polr1c standard conditions Fig. 8 from Lau et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.