Morpholino
MO1-dnajc9
- ID
- ZDB-MRPHLNO-160629-5
- Name
- MO1-dnajc9
- Previous Names
- None
- Target
- Sequence
-
5' - GTAATCTGCGGCAGAAGTGTCACAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnajc9
No data available
Phenotype
Phenotype resulting from MO1-dnajc9
| Phenotype | Fish | Figures |
|---|---|---|
| spinal cord curved, abnormal | WT + MO1-dnajc9 |
Fig. 6 |
Phenotype of all Fish created by or utilizing MO1-dnajc9
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| spinal cord curved, abnormal | WT + MO1-dnajc9 | standard conditions |
Fig. 6 |
Citations