Morpholino

MO1-gmnc

ID

ZDB-MRPHLNO-160616-1

Name

MO1-gmnc

Previous Names

None

Target

gmnc (1)

Sequence

5' - CGGCATATTGCAGGACTTACCCCGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

designed to inhibit splicing at the exon 2/intron2-3 junction of zebrafish gmnc pre-mRNA. (Zhou et al. ZDB-PUB-160119-4)

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gmnc

Expressed Gene	Anatomy	Figures
mcidas	(not) pronephric tubule multi-ciliated epithelial cell	Fig. 2 from Zhou et al., 2015

Phenotype

Phenotype resulting from MO1-gmnc

Phenotype	Fish	Figures
pronephric duct multi-ciliated epithelial cell GFP expression absent, abnormal	zf417Tg + MO1-gmnc	Fig. 2 from Zhou et al., 2015
pronephric tubule lacks parts or has fewer parts of type pronephric tubule multi-ciliated epithelial cell, abnormal	WT + MO1-gmnc	Fig. 1 from Zhou et al., 2015
pronephros cystic, abnormal	WT + MO1-gmnc	Fig. 1 from Zhou et al., 2015
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal	WT + MO1-gmnc	Fig. 1 , Fig. 2 from Zhou et al., 2015

Phenotype of all Fish created by or utilizing MO1-gmnc

Phenotype	Fish	Conditions	Figures
pronephros cystic, abnormal	WT + MO1-gmnc	standard conditions	Fig. 1 from Zhou et al., 2015
pronephric tubule lacks parts or has fewer parts of type pronephric tubule multi-ciliated epithelial cell, abnormal	WT + MO1-gmnc	standard conditions	Fig. 1 from Zhou et al., 2015
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal	WT + MO1-gmnc	standard conditions	Fig. 1 from Zhou et al., 2015
pronephric duct multi-ciliated epithelial cell GFP expression absent, abnormal	zf417Tg + MO1-gmnc	standard conditions	Fig. 2 from Zhou et al., 2015
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal	zf417Tg + MO1-gmnc	standard conditions	Fig. 2 from Zhou et al., 2015
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal	mib1^ta52b/ta52b + MO1-gmnc	standard conditions	Fig. 2 from Zhou et al., 2015
pronephric tubule lacks parts or has fewer parts of type pronephric tubule multi-ciliated epithelial cell, abnormal	mib1^ta52b/ta52b + MO1-gmnc	standard conditions	Fig. 2 from Zhou et al., 2015
pronephric tubule multi-ciliated epithelial cell mcidas expression absent, abnormal	mib1^ta52b/ta52b + MO1-gmnc	standard conditions	Fig. 2 from Zhou et al., 2015
pronephric tubule lacks parts or has fewer parts of type pronephric tubule multi-ciliated epithelial cell, abnormal	WT + MO1-gmnc + MO5-jag2b	standard conditions	Fig. 2 from Zhou et al., 2015
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal	WT + MO1-gmnc + MO5-jag2b	standard conditions	Fig. 2 from Zhou et al., 2015

Citations