Morpholino

MO2-adss1

ID

ZDB-MRPHLNO-160415-4

Name

MO2-adss1

Previous Names

Target

Sequence

5' - ATAAAGGGTGTTTGTCCTACATTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-adss1

No data available

Phenotype

Phenotype resulting from MO2-adss1

Phenotype	Fish	Figures
muscle refractivity, abnormal	AB + MO2-adss1	Fig. 5 from Park et al., 2016
muscle skeletal muscle myofibril disorganized, abnormal	AB + MO2-adss1	Fig. 5 from Park et al., 2016
muscle cell development disrupted, abnormal	AB + MO2-adss1	Fig. 5 from Park et al., 2016
myoseptum damaged, abnormal	AB + MO2-adss1	Fig. 5 from Park et al., 2016
myoseptum U-shaped, abnormal	AB + MO2-adss1	Fig. 8 from Kwon et al., 2016 Fig. 5 from Park et al., 2016
skeletal muscle skeletal muscle myofibril morphology, abnormal	AB + MO2-adss1	Fig. 8 from Kwon et al., 2016
skeletal muscle cell apoptotic, abnormal	AB + MO2-adss1	Fig. 7 from Kwon et al., 2016
skeletal muscle cell apoptotic process increased occurrence, abnormal	AB + MO2-adss1	Fig. 7 from Kwon et al., 2016
trunk curved, abnormal	AB + MO2-adss1	Fig. S5 from Kwon et al., 2016

Phenotype of all Fish created by or utilizing MO2-adss1

Phenotype	Fish	Conditions	Figures
skeletal muscle skeletal muscle myofibril morphology, abnormal	AB + MO2-adss1	standard conditions	Fig. 8 from Kwon et al., 2016
muscle skeletal muscle myofibril disorganized, abnormal	AB + MO2-adss1	standard conditions	Fig. 5 from Park et al., 2016
trunk curved, abnormal	AB + MO2-adss1	standard conditions	Fig. S5 from Kwon et al., 2016
muscle refractivity, abnormal	AB + MO2-adss1	standard conditions	Fig. 5 from Park et al., 2016
myoseptum U-shaped, abnormal	AB + MO2-adss1	standard conditions	Fig. 8 from Kwon et al., 2016 Fig. 5 from Park et al., 2016
myoseptum damaged, abnormal	AB + MO2-adss1	standard conditions	Fig. 5 from Park et al., 2016
skeletal muscle cell apoptotic process increased occurrence, abnormal	AB + MO2-adss1	standard conditions	Fig. 7 from Kwon et al., 2016
muscle cell development disrupted, abnormal	AB + MO2-adss1	standard conditions	Fig. 5 from Park et al., 2016
skeletal muscle cell apoptotic, abnormal	AB + MO2-adss1	standard conditions	Fig. 7 from Kwon et al., 2016

Citations