Morpholino

MO1-adgrb1b

ID
ZDB-MRPHLNO-160413-3
Name
MO1-adgrb1b
Previous Names
  • 1 and 2 exons (1)
Target
Sequence
5' - CTAGAACTCTAACACACTTACTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adgrb1b
No data available
Phenotype
Phenotype resulting from MO1-adgrb1b
No data available
Phenotype of all Fish created by or utilizing MO1-adgrb1b
Phenotype Fish Conditions Figures
brain apoptotic cell clearance decreased occurrence, abnormal hdb2Tg ; hdb6Tg + MO1-adgrb1b + MO2-adgrb1b control Fig. 4 from Mazaheri et al., 2014
brain engulfment of apoptotic cell process quality, abnormal hdb2Tg ; hdb6Tg + MO1-adgrb1b + MO2-adgrb1b control Fig. 6 from Mazaheri et al., 2014
brain engulfment of apoptotic cell decreased efficacy, abnormal hdb2Tg ; hdb6Tg + MO1-adgrb1b + MO2-adgrb1b control Fig. 5 from Mazaheri et al., 2014
brain apoptotic cell clearance process quality, abnormal hdb2Tg ; hdb6Tg + MO1-adgrb1b + MO2-adgrb1b control Fig. 6 from Mazaheri et al., 2014
brain phagolysosome assembly involved in apoptotic cell clearance increased duration, abnormal hdb2Tg ; hdb6Tg + MO1-adgrb1b + MO2-adgrb1b control Fig. 5 from Mazaheri et al., 2014
brain engulfment of apoptotic cell increased duration, abnormal hdb2Tg ; hdb6Tg + MO1-adgrb1b + MO2-adgrb1b control Fig. 5 from Mazaheri et al., 2014
brain engulfment of apoptotic cell process quality, abnormal hdb2Tg ; hdb6Tg + MO1-adgrb1b + MO1-havcr1 + MO2-adgrb1b + MO2-havcr1 control Fig. 6 from Mazaheri et al., 2014
brain apoptotic cell clearance decreased occurrence, abnormal hdb2Tg ; hdb6Tg + MO1-adgrb1b + MO1-havcr1 + MO2-adgrb1b + MO2-havcr1 control Fig. 4 from Mazaheri et al., 2014
brain apoptotic cell clearance process quality, abnormal hdb2Tg ; hdb6Tg + MO1-adgrb1b + MO1-havcr1 + MO2-adgrb1b + MO2-havcr1 control Fig. 6 from Mazaheri et al., 2014
brain phagolysosome assembly involved in apoptotic cell clearance increased duration, abnormal hdb2Tg ; hdb6Tg + MO1-adgrb1b + MO1-havcr1 + MO2-adgrb1b + MO2-havcr1 control Fig. 5 from Mazaheri et al., 2014
microglial cell phagocytic vesicle diameter, ameliorated slc37a2t30301/t30301 ; zf149Tg + MO1-adgrb1b + MO1-havcr1 standard conditions Fig. 2 with image from Villani et al., 2019
microglial cell phagocytosis, engulfment decreased occurrence, abnormal slc37a2t30301/t30301 ; zf149Tg + MO1-adgrb1b + MO1-havcr1 standard conditions Fig. 2 with image from Villani et al., 2019
microglial cell size, ameliorated slc37a2t30301/t30301 ; zf149Tg + MO1-adgrb1b + MO1-havcr1 standard conditions Fig. 2 with image from Villani et al., 2019
Citations