Morpholino

MO1-tmem234

ID

ZDB-MRPHLNO-160301-6

Name

MO1-tmem234

Previous Names

I1E2 (1)

Target

tmem234 (1)

Sequence

5' - CAGACAAAACACTTCACCTGGACGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tmem234

No data available

Phenotype

Phenotype resulting from MO1-tmem234

Phenotype	Fish	Figures
glomerular filtration disrupted, abnormal	ki1Tg + MO1-tmem234	Fig. 10 from Rodriguez et al., 2015
pericardium edematous, abnormal	ki1Tg + MO1-tmem234	Fig. 8, Fig. 11 from Rodriguez et al., 2015
pronephric capsular space dilated, abnormal	ki1Tg + MO1-tmem234	Fig. 8 from Rodriguez et al., 2015
pronephric glomerulus disorganized, abnormal	ki1Tg + MO1-tmem234	Fig. 8 from Rodriguez et al., 2015
pronephric glomerulus hypoplastic, abnormal	ki1Tg + MO1-tmem234	Fig. 9 from Rodriguez et al., 2015
pronephric glomerulus cell decreased amount, abnormal	ki1Tg + MO1-tmem234	Fig. 9 from Rodriguez et al., 2015
pronephric podocyte EGFP expression absent, abnormal	ki1Tg + MO1-tmem234	Fig. 8, Fig. 11 from Rodriguez et al., 2015
pronephric podocyte podocyte foot decreased amount, abnormal	ki1Tg + MO1-tmem234	Fig. 10 from Rodriguez et al., 2015
whole organism EGFP expression decreased amount, abnormal	ki1Tg + MO1-tmem234	Fig. 9, Fig. 11 from Rodriguez et al., 2015

Phenotype of all Fish created by or utilizing MO1-tmem234

Phenotype	Fish	Conditions	Figures
pronephric podocyte podocyte foot decreased amount, abnormal	ki1Tg + MO1-tmem234	standard conditions	Fig. 10 from Rodriguez et al., 2015
pronephric capsular space dilated, abnormal	ki1Tg + MO1-tmem234	standard conditions	Fig. 8 from Rodriguez et al., 2015
pronephric podocyte EGFP expression absent, abnormal	ki1Tg + MO1-tmem234	standard conditions	Fig. 8 from Rodriguez et al., 2015
whole organism EGFP expression decreased amount, abnormal	ki1Tg + MO1-tmem234	standard conditions	Fig. 9 from Rodriguez et al., 2015
pronephric glomerulus hypoplastic, abnormal	ki1Tg + MO1-tmem234	standard conditions	Fig. 9 from Rodriguez et al., 2015
glomerular filtration disrupted, abnormal	ki1Tg + MO1-tmem234	standard conditions	Fig. 10 from Rodriguez et al., 2015
pronephric glomerulus disorganized, abnormal	ki1Tg + MO1-tmem234	standard conditions	Fig. 8 from Rodriguez et al., 2015
pericardium edematous, abnormal	ki1Tg + MO1-tmem234	standard conditions	Fig. 8 from Rodriguez et al., 2015
pronephric glomerulus cell decreased amount, abnormal	ki1Tg + MO1-tmem234	standard conditions	Fig. 9 from Rodriguez et al., 2015
pericardium edematous, abnormal	ki1Tg + MO1-tmem234 + MO4-tp53	standard conditions	Fig. 11 from Rodriguez et al., 2015
pronephric podocyte EGFP expression absent, abnormal	ki1Tg + MO1-tmem234 + MO4-tp53	standard conditions	Fig. 11 from Rodriguez et al., 2015
whole organism EGFP expression decreased amount, abnormal	ki1Tg + MO1-tmem234 + MO4-tp53	standard conditions	Fig. 11 from Rodriguez et al., 2015

Citations