Morpholino

MO1-naa10

ID
ZDB-MRPHLNO-151230-2
Name
MO1-naa10
Previous Names
None
Target
Sequence
5' - GGACAGCTTTAACAAAATGAACACA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-naa10
No data available
Phenotype
Phenotype resulting from MO1-naa10
Phenotype Fish Figures
embryo development disrupted, abnormal WT + MO1-naa10 Fig. 5,  Fig. 6 from Ree et al., 2015
eye malformed, abnormal WT + MO1-naa10 Fig. 5,  Fig. S1 from Ree et al., 2015
eye morphology, abnormal WT + MO1-naa10 + MO4-tp53 Fig. 5,  Fig. S1 from Ree et al., 2015
head decreased size, abnormal WT + MO1-naa10 Fig. 6 from Ree et al., 2015
heart edematous, abnormal WT + MO1-naa10 Fig. 6 from Ree et al., 2015
post-vent region curved, abnormal WT + MO1-naa10 Fig. 6 from Ree et al., 2015
ventral mandibular arch decreased size, abnormal WT + MO1-naa10 Fig. 6 from Ree et al., 2015
whole organism decreased length, abnormal WT + MO1-naa10 Fig. 5,  Fig. 6,  Fig. S1 from Ree et al., 2015
whole organism decreased pigmentation, abnormal WT + MO1-naa10 + MO4-tp53 Fig. 5,  Fig. S1 from Ree et al., 2015
whole organism anatomical axis bent, abnormal WT + MO1-naa10 Fig. 5,  Fig. 6 from Ree et al., 2015
yolk syncytial layer increased size, abnormal WT + MO1-naa10 Fig. 6 from Ree et al., 2015
Phenotype of all Fish created by or utilizing MO1-naa10
Phenotype Fish Conditions Figures
post-vent region curved, abnormal WT + MO1-naa10 standard conditions Fig. 6 from Ree et al., 2015
head decreased size, abnormal WT + MO1-naa10 standard conditions Fig. 6 from Ree et al., 2015
yolk syncytial layer increased size, abnormal WT + MO1-naa10 standard conditions Fig. 6 from Ree et al., 2015
heart edematous, abnormal WT + MO1-naa10 standard conditions Fig. 6 from Ree et al., 2015
whole organism decreased pigmentation, abnormal WT + MO1-naa10 standard conditions Fig. 5 from Ree et al., 2015
whole organism decreased length, abnormal WT + MO1-naa10 standard conditions Fig. 5,  Fig. 6 from Ree et al., 2015
ventral mandibular arch decreased size, abnormal WT + MO1-naa10 standard conditions Fig. 6 from Ree et al., 2015
whole organism anatomical axis bent, abnormal WT + MO1-naa10 standard conditions Fig. 5,  Fig. 6 from Ree et al., 2015
eye malformed, abnormal WT + MO1-naa10 standard conditions Fig. 5 from Ree et al., 2015
embryo development disrupted, abnormal WT + MO1-naa10 standard conditions Fig. 5,  Fig. 6 from Ree et al., 2015
eye morphology, abnormal WT + MO1-naa10 standard conditions Fig. 5 from Ree et al., 2015
whole organism decreased pigmentation, abnormal WT + MO1-naa10 + MO4-tp53 standard conditions Fig. S1 from Ree et al., 2015
whole organism decreased length, abnormal WT + MO1-naa10 + MO4-tp53 standard conditions Fig. S1 from Ree et al., 2015
eye morphology, abnormal WT + MO1-naa10 + MO4-tp53 standard conditions Fig. S1 from Ree et al., 2015
eye malformed, abnormal WT + MO1-naa10 + MO4-tp53 standard conditions Fig. S1 from Ree et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.