Morpholino
MO2-egfl6
- ID
- ZDB-MRPHLNO-151116-5
- Name
- MO2-egfl6
- Previous Names
- None
- Target
- Sequence
-
5' - TCTGCTAAATCACCTTCACATTGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-egfl6
No data available
Phenotype
Phenotype resulting from MO2-egfl6
| Phenotype | Fish | Figures |
|---|---|---|
| notochord deformed, abnormal | AB + MO2-egfl6 |
text only
from Wang et al., 2015 |
| trunk curved, abnormal | AB + MO2-egfl6 |
text only
from Wang et al., 2015 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-egfl6
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| notochord deformed, abnormal | AB + MO2-egfl6 | standard conditions |
text only
from Wang et al., 2015 |
| trunk curved, abnormal | AB + MO2-egfl6 | standard conditions |
text only
from Wang et al., 2015 |
1 - 2 of 2
Citations
- Jin, S., Na, H., Jeon, H., Park, J., Choe, C.P. (2021) egfl6 expression in the pharyngeal pouch is dispensable for craniofacial development. Animal cells and systems. 25:255-263
- Wang, X., Wang, X., Yuan, W., Chai, R., Liu, D. (2015) Egfl6 is involved in zebrafish notochord development. Fish physiology and biochemistry. 41(4):961-9
1 - 2 of 2
Show