ZFIN ID: ZDB-MRPHLNO-151013-6
Morpholino Name: MO2-setd7
Target: setd7 (1)
Sequence:
5' - AGCTTCTCGTACCTTCCACCACTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-setd7 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-setd7
Expressed Gene Anatomy Figures
myh6 Fig. 6 from Kim et al., 2015
myh7 Fig. 6 from Kim et al., 2015
myl7 Fig. 6 from Kim et al., 2015
setd7 Fig. 4 from Kim et al., 2015
PHENOTYPE
Phenotype resulting from MO2-setd7
Phenotype of all Fish created by or utilizing MO2-setd7
Phenotype Fish Conditions Figures
pericardium edematous, abnormal AB + MO2-setd7 standard conditions Fig. 4 from Kim et al., 2015
heart linear, abnormal twu34Tg + MO2-setd7 standard conditions Fig. 6 from Kim et al., 2015
heart hypoplastic, abnormal twu34Tg + MO2-setd7 standard conditions Fig. 6 from Kim et al., 2015
heart looping disrupted, abnormal twu34Tg + MO2-setd7 standard conditions Fig. 6 from Kim et al., 2015
heart morphogenesis disrupted, abnormal twu34Tg + MO2-setd7 standard conditions Fig. 6 from Kim et al., 2015
heart morphology, abnormal twu34Tg + MO2-setd7 standard conditions Fig. 6 from Kim et al., 2015
whole organism curved, abnormal AB + MO2-setd7 + MO4-smyd3 standard conditions Fig. 5 from Kim et al., 2015
whole organism monstrous, abnormal AB + MO2-setd7 + MO4-smyd3 standard conditions Fig. 5 from Kim et al., 2015
whole organism decreased length, abnormal AB + MO2-setd7 + MO4-smyd3 standard conditions Fig. 5 from Kim et al., 2015
heart linear, abnormal twu34Tg + MO2-setd7 + MO4-smyd3 standard conditions Fig. 6 from Kim et al., 2015
heart hypoplastic, abnormal twu34Tg + MO2-setd7 + MO4-smyd3 standard conditions Fig. 6 from Kim et al., 2015
heart looping disrupted, abnormal twu34Tg + MO2-setd7 + MO4-smyd3 standard conditions Fig. 6 from Kim et al., 2015
heart morphology, abnormal twu34Tg + MO2-setd7 + MO4-smyd3 standard conditions Fig. 6 from Kim et al., 2015
heart morphogenesis disrupted, abnormal twu34Tg + MO2-setd7 + MO4-smyd3 standard conditions Fig. 6 from Kim et al., 2015
Genome Resources:
CITATIONS (1)