Morpholino

MO2-klf8

ID
ZDB-MRPHLNO-150928-4
Name
MO2-klf8
Previous Names
  • klf8-MO2 ATG (1)
Target
Sequence
5' - TTTTGTTCCGAGTCTCCGTGTGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-klf8
Expressed Gene Anatomy Figures
gata6 Fig. 1 with image from Lin et al., 2017
lft1 Fig. 2 with image from Lin et al., 2017
lft2 Fig. 2 with image from Lin et al., 2017
myl7 Fig. 1 with image from Lin et al., 2017
pitx2 Fig. 2 with image from Lin et al., 2017
spaw Fig. 2 with image,  Fig. 3 with image from Lin et al., 2017
tp53 Fig. 2 with image from Tsai et al., 2015
Phenotype
Phenotype resulting from MO2-klf8
Phenotype Fish Figures
anterior lateral plate mesoderm spaw expression absent, abnormal AB + MO2-klf8 Fig. 2 with image from Lin et al., 2017
cerebellum morphology, abnormal WT + MO2-klf8 Fig. 1 with image from Tsai et al., 2015
cerebellum apoptotic process increased occurrence, abnormal WT + MO2-klf8 Fig. 3 with image from Tsai et al., 2015
cerebellum cell proliferation in hindbrain decreased occurrence, abnormal WT + MO2-klf8 Fig. 3 with image from Tsai et al., 2015
cerebellum development disrupted, abnormal WT + MO2-klf8 Fig. 1 with image from Tsai et al., 2015
determination of intestine left/right asymmetry arrested, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
determination of intestine left/right asymmetry process quality, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
diencephalon left side lft1 expression absent, abnormal AB + MO2-klf8 Fig. 2 with image from Lin et al., 2017
eye decreased size, abnormal WT + MO2-klf8 Fig. 1 with image from Tsai et al., 2015
heart morphology, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
heart jogging arrested, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
heart jogging process quality, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
heart looping arrested, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
heart looping process quality, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
heart rudiment lft1 expression absent, abnormal AB + MO2-klf8 Fig. 2 with image from Lin et al., 2017
heart rudiment lft2 expression absent, abnormal AB + MO2-klf8 Fig. 2 with image from Lin et al., 2017
heart tube displaced to whole organism right side, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
heart tube medial orientation, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
Kupffer's vesicle cilium decreased amount, abnormal s870Tg + MO2-klf8 Fig. 5 with image from Lin et al., 2017
Kupffer's vesicle cilium decreased length, abnormal s870Tg + MO2-klf8 Fig. 5 with image from Lin et al., 2017
lateral plate mesoderm spaw expression absent, abnormal AB + MO2-klf8 Fig. 2 with image from Lin et al., 2017
lateral plate mesoderm spaw expression decreased amount, abnormal AB + MO2-klf8 Fig. 2 with image from Lin et al., 2017
lateral plate mesoderm left side pitx2 expression absent, abnormal AB + MO2-klf8 Fig. 2 with image from Lin et al., 2017
lateral plate mesoderm left side spaw expression absent, abnormal AB + MO2-klf8 Fig. 3 with image from Lin et al., 2017
lateral plate mesoderm left side spaw expression decreased amount, abnormal AB + MO2-klf8 Fig. 2 with image from Lin et al., 2017
liver aplastic, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
liver bilateral, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
liver mislocalised, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
pancreas aplastic, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
pancreas bilateral, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
pancreas mislocalised, abnormal AB + MO2-klf8 Fig. 1 with image from Lin et al., 2017
posterior lateral plate mesoderm spaw expression decreased amount, abnormal AB + MO2-klf8 Fig. 2 with image from Lin et al., 2017
whole organism has fewer parts of type forerunner cell group, abnormal s870Tg + MO2-klf8 Fig. 5 with image from Lin et al., 2017
Phenotype of all Fish created by or utilizing MO2-klf8
Phenotype Fish Conditions Figures
heart tube displaced to whole organism right side, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
heart tube medial orientation, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
determination of intestine left/right asymmetry process quality, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
lateral plate mesoderm left side spaw expression absent, abnormal AB + MO2-klf8 standard conditions Fig. 3 with image from Lin et al., 2017
heart jogging process quality, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
lateral plate mesoderm left side spaw expression decreased amount, abnormal AB + MO2-klf8 standard conditions Fig. 2 with image from Lin et al., 2017
liver mislocalised, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
liver bilateral, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
lateral plate mesoderm left side pitx2 expression absent, abnormal AB + MO2-klf8 standard conditions Fig. 2 with image from Lin et al., 2017
anterior lateral plate mesoderm spaw expression absent, abnormal AB + MO2-klf8 standard conditions Fig. 2 with image from Lin et al., 2017
heart rudiment lft2 expression absent, abnormal AB + MO2-klf8 standard conditions Fig. 2 with image from Lin et al., 2017
pancreas aplastic, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
determination of intestine left/right asymmetry arrested, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
lateral plate mesoderm spaw expression absent, abnormal AB + MO2-klf8 standard conditions Fig. 2 with image from Lin et al., 2017
heart looping arrested, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
pancreas bilateral, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
heart jogging arrested, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
heart looping process quality, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
pancreas mislocalised, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
posterior lateral plate mesoderm spaw expression decreased amount, abnormal AB + MO2-klf8 standard conditions Fig. 2 with image from Lin et al., 2017
heart rudiment lft1 expression absent, abnormal AB + MO2-klf8 standard conditions Fig. 2 with image from Lin et al., 2017
lateral plate mesoderm spaw expression decreased amount, abnormal AB + MO2-klf8 standard conditions Fig. 2 with image from Lin et al., 2017
diencephalon left side lft1 expression absent, abnormal AB + MO2-klf8 standard conditions Fig. 2 with image from Lin et al., 2017
heart morphology, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
liver aplastic, abnormal AB + MO2-klf8 standard conditions Fig. 1 with image from Lin et al., 2017
cerebellum development disrupted, abnormal WT + MO2-klf8 standard conditions Fig. 1 with image from Tsai et al., 2015
eye decreased size, abnormal WT + MO2-klf8 standard conditions Fig. 1 with image from Tsai et al., 2015
cerebellum cell proliferation in hindbrain decreased occurrence, abnormal WT + MO2-klf8 standard conditions Fig. 3 with image from Tsai et al., 2015
cerebellum apoptotic process increased occurrence, abnormal WT + MO2-klf8 standard conditions Fig. 3 with image from Tsai et al., 2015
cerebellum morphology, abnormal WT + MO2-klf8 standard conditions Fig. 1 with image from Tsai et al., 2015
Kupffer's vesicle cilium decreased amount, abnormal s870Tg + MO2-klf8 standard conditions Fig. 5 with image from Lin et al., 2017
whole organism has fewer parts of type forerunner cell group, abnormal s870Tg + MO2-klf8 standard conditions Fig. 5 with image from Lin et al., 2017
Kupffer's vesicle cilium decreased length, abnormal s870Tg + MO2-klf8 standard conditions Fig. 5 with image from Lin et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.