Morpholino
MO7-dnmt1
- ID
- ZDB-MRPHLNO-150720-1
- Name
- MO7-dnmt1
- Previous Names
- None
- Target
- Sequence
-
5' - CCACCCTTCAAAACAATAACAGTGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-dnmt1
Expressed Gene | Anatomy | Figures |
---|---|---|
cebpa |
Fig. 5
from Wang et al., 2018 |
|
mpx |
Fig. 5
from Wang et al., 2018 |
|
myb |
Fig. 3 ![]() |
Phenotype
Phenotype resulting from MO7-dnmt1
Phenotype of all Fish created by or utilizing MO7-dnmt1
Citations
- Wang, L., Liu, X., Wang, H., Yuan, H., Chen, S., Chen, Z., de The, H., Zhou, J., Zhu, J. (2018) RNF4 regulates zebrafish granulopoiesis through the DNMT1-C/EBPα axis. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 32(9):4930-4940
- Liu, X., Jia, X., Yuan, H., Ma, K., Chen, Y., Jin, Y., Deng, M., Pan, W., Chen, S., Chen, Z., de The, H., Zon, L.I., Zhou, Y., Zhou, J., Zhu, J. (2015) DNA methyltransferase 1 functions through C/ebpa to maintain hematopoietic stem and progenitor cells in zebrafish. Journal of Hematology & Oncology. 8:15
1 - 2 of 2
Show