Morpholino

MO3-fhl1a

ID

ZDB-MRPHLNO-150622-3

Name

MO3-fhl1a

Previous Names

None

Target

fhl1a (1)

Sequence

5' - ATTGTCGTTTAACTCGTACCTTTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-fhl1a

No data available

Phenotype

Phenotype resulting from MO3-fhl1a

Phenotype	Fish	Figures
hatching disrupted, abnormal	WT + MO3-fhl1a	Fig. S2 from Keßler et al., 2018
heart decreased functionality, abnormal	WT + MO3-fhl1a	Fig. 3 from Keßler et al., 2018
heart contraction decreased rate, abnormal	WT + MO3-fhl1a	Fig. 3 from Keßler et al., 2018
locomotion disrupted, abnormal	WT + MO3-fhl1a	Fig. 2 from Bührdel et al., 2015
skeletal muscle decreased amount, abnormal	WT + MO3-fhl1a	Fig. 2 from Keßler et al., 2018
skeletal muscle morphology, abnormal	WT + MO3-fhl1a	Fig. 2 from Keßler et al., 2018
skeletal muscle refractivity, abnormal	WT + MO3-fhl1a	Fig. 2 from Keßler et al., 2018
skeletal muscle contractile muscle fiber decreased amount, abnormal	WT + MO3-fhl1a	Fig. 2 from Keßler et al., 2018
skeletal muscle mitochondrion morphology, abnormal	WT + MO3-fhl1a	Fig. 2 from Keßler et al., 2018
skeletal muscle sarcoplasmic reticulum increased size, abnormal	WT + MO3-fhl1a	Fig. 2 from Keßler et al., 2018
skeletal muscle skeletal muscle myofibril disorganized, abnormal	WT + MO3-fhl1a	Fig. 2 from Keßler et al., 2018
thigmotaxis disrupted, abnormal	WT + MO3-fhl1a	Fig. 2 from Bührdel et al., 2015
whole organism decreased mobility, abnormal	WT + MO3-fhl1a	Fig. 2 from Bührdel et al., 2015
whole organism larval locomotory behavior process quality, abnormal	WT + MO3-fhl1a	Fig. S2 from Keßler et al., 2018

Phenotype of all Fish created by or utilizing MO3-fhl1a

Phenotype	Fish	Conditions	Figures
skeletal muscle refractivity, abnormal	WT + MO3-fhl1a	standard conditions	Fig. 2 from Keßler et al., 2018
heart decreased functionality, abnormal	WT + MO3-fhl1a	standard conditions	Fig. 3 from Keßler et al., 2018
hatching disrupted, abnormal	WT + MO3-fhl1a	standard conditions	Fig. S2 from Keßler et al., 2018
skeletal muscle mitochondrion morphology, abnormal	WT + MO3-fhl1a	standard conditions	Fig. 2 from Keßler et al., 2018
skeletal muscle morphology, abnormal	WT + MO3-fhl1a	standard conditions	Fig. 2 from Keßler et al., 2018
heart contraction decreased rate, abnormal	WT + MO3-fhl1a	standard conditions	Fig. 3 from Keßler et al., 2018
whole organism decreased mobility, abnormal	WT + MO3-fhl1a	standard conditions	Fig. 2 from Bührdel et al., 2015
skeletal muscle skeletal muscle myofibril disorganized, abnormal	WT + MO3-fhl1a	standard conditions	Fig. 2 from Keßler et al., 2018
locomotion disrupted, abnormal	WT + MO3-fhl1a	standard conditions	Fig. 2 from Bührdel et al., 2015
skeletal muscle decreased amount, abnormal	WT + MO3-fhl1a	standard conditions	Fig. 2 from Keßler et al., 2018
thigmotaxis disrupted, abnormal	WT + MO3-fhl1a	standard conditions	Fig. 2 from Bührdel et al., 2015
skeletal muscle sarcoplasmic reticulum increased size, abnormal	WT + MO3-fhl1a	standard conditions	Fig. 2 from Keßler et al., 2018
whole organism larval locomotory behavior process quality, abnormal	WT + MO3-fhl1a	standard conditions	Fig. S2 from Keßler et al., 2018
skeletal muscle contractile muscle fiber decreased amount, abnormal	WT + MO3-fhl1a	standard conditions	Fig. 2 from Keßler et al., 2018

Citations