Morpholino

MO2-ift46

ID

ZDB-MRPHLNO-150618-1

Name

MO2-ift46

Previous Names

Target

Sequence

5' - CTTTTGTCGCTCGGACCTCTCCATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-ift46

No data available

Phenotype

Phenotype resulting from MO2-ift46

Phenotype	Fish	Figures
neuromast hair cell kinocilium decreased length, abnormal	WT + MO2-ift46	Fig. 4 from Lee et al., 2015
olfactory pit cilium decreased length, abnormal	WT + MO2-ift46	Fig. 4 from Lee et al., 2015
otic vesicle cilium absent, abnormal	WT + MO2-ift46	Fig. 4 from Lee et al., 2015
otic vesicle cilium decreased length, abnormal	WT + MO2-ift46	Fig. 4 from Lee et al., 2015
pericardium edematous, abnormal	WT + MO2-ift46	Fig. 3 from Lee et al., 2015
photoreceptor outer segment layer decreased thickness, abnormal	WT + MO2-ift46	Fig. 3 from Lee et al., 2015
pronephric duct dilated, abnormal	WT + MO2-ift46	Fig. 3 from Lee et al., 2015
pronephric duct cilium decreased amount, abnormal	WT + MO2-ift46	Fig. 4 from Lee et al., 2015
pronephric duct motile cilium decreased length, abnormal	WT + MO2-ift46	Fig. 4 from Lee et al., 2015
pronephric duct motile cilium disorganized, abnormal	WT + MO2-ift46	Fig. 4 from Lee et al., 2015
pronephric glomerulus cystic, abnormal	WT + MO2-ift46	Fig. 3 from Lee et al., 2015
pronephros cystic, abnormal	WT + MO2-ift46	Fig. 3 from Lee et al., 2015
trunk anatomical axis curved, abnormal	WT + MO2-ift46	Fig. 3 from Lee et al., 2015

Phenotype of all Fish created by or utilizing MO2-ift46

Phenotype	Fish	Conditions	Figures
pronephric duct dilated, abnormal	WT + MO2-ift46	standard conditions	Fig. 3 from Lee et al., 2015
pericardium edematous, abnormal	WT + MO2-ift46	standard conditions	Fig. 3 from Lee et al., 2015
pronephros cystic, abnormal	WT + MO2-ift46	standard conditions	Fig. 3 from Lee et al., 2015
otic vesicle cilium decreased length, abnormal	WT + MO2-ift46	standard conditions	Fig. 4 from Lee et al., 2015
pronephric duct cilium decreased amount, abnormal	WT + MO2-ift46	standard conditions	Fig. 4 from Lee et al., 2015
pronephric glomerulus cystic, abnormal	WT + MO2-ift46	standard conditions	Fig. 3 from Lee et al., 2015
trunk anatomical axis curved, abnormal	WT + MO2-ift46	standard conditions	Fig. 3 from Lee et al., 2015
pronephric duct motile cilium disorganized, abnormal	WT + MO2-ift46	standard conditions	Fig. 4 from Lee et al., 2015
otic vesicle cilium absent, abnormal	WT + MO2-ift46	standard conditions	Fig. 4 from Lee et al., 2015
pronephric duct motile cilium decreased length, abnormal	WT + MO2-ift46	standard conditions	Fig. 4 from Lee et al., 2015
olfactory pit cilium decreased length, abnormal	WT + MO2-ift46	standard conditions	Fig. 4 from Lee et al., 2015
neuromast hair cell kinocilium decreased length, abnormal	WT + MO2-ift46	standard conditions	Fig. 4 from Lee et al., 2015
photoreceptor outer segment layer decreased thickness, abnormal	WT + MO2-ift46	standard conditions	Fig. 3 from Lee et al., 2015

Citations