Morpholino

MO2-ndst1a

ID

ZDB-MRPHLNO-150602-3

Name

MO2-ndst1a

Previous Names

intron 5–6/exon 6 (1)

Target

ndst1a (1)

Sequence

5' - TGATCCTACAGGACAAAACACAACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-ndst1a

No data available

Phenotype

Phenotype resulting from MO2-ndst1a

Phenotype	Fish	Figures
basihyal cartilage decreased size, abnormal	y1Tg + MO2-ndst1a + MO4-tp53	Fig. 6 from Filipek-Górniok et al., 2015
ceratohyal bone mislocalised, abnormal	WT + MO2-ndst1a + MO4-tp53	Fig. 6 from Filipek-Górniok et al., 2015
eye decreased size, abnormal	WT + MO2-ndst1a + MO4-tp53	Fig. 6 from Filipek-Górniok et al., 2015
head decreased size, abnormal	WT + MO2-ndst1a + MO4-tp53	Fig. 6 from Filipek-Górniok et al., 2015
pectoral fin decreased length, abnormal	WT + MO2-ndst1a + MO4-tp53	Fig. 6 from Filipek-Górniok et al., 2015
pharyngeal arch 3-7 skeleton decreased size, abnormal	y1Tg + MO2-ndst1a + MO4-tp53	Fig. 6 from Filipek-Górniok et al., 2015
pharyngeal arch cartilage decreased size, abnormal	WT + MO2-ndst1a + MO4-tp53	Fig. 6 from Filipek-Górniok et al., 2015
pharyngeal arch cartilage malformed, abnormal	y1Tg + MO2-ndst1a + MO4-tp53	Fig. 6 from Filipek-Górniok et al., 2015
whole organism decreased length, abnormal	WT + MO2-ndst1a + MO4-tp53	Fig. 6 from Filipek-Górniok et al., 2015
whole organism has fewer parts of type swim bladder, abnormal	WT + MO2-ndst1a + MO4-tp53	Fig. 6 from Filipek-Górniok et al., 2015

Phenotype of all Fish created by or utilizing MO2-ndst1a

Phenotype	Fish	Conditions	Figures
ceratohyal bone mislocalised, abnormal	WT + MO1-ndst1a + MO2-ndst1a + MO4-tp53	standard conditions	Fig. 6 from Filipek-Górniok et al., 2015
ceratohyal bone mislocalised, abnormal	WT + MO2-ndst1a + MO4-tp53	standard conditions	Fig. 6 from Filipek-Górniok et al., 2015
eye decreased size, abnormal	WT + MO2-ndst1a + MO4-tp53	standard conditions	Fig. 6 from Filipek-Górniok et al., 2015
whole organism decreased length, abnormal	WT + MO2-ndst1a + MO4-tp53	standard conditions	Fig. 6 from Filipek-Górniok et al., 2015
pharyngeal arch cartilage decreased size, abnormal	WT + MO2-ndst1a + MO4-tp53	standard conditions	Fig. 6 from Filipek-Górniok et al., 2015
whole organism has fewer parts of type swim bladder, abnormal	WT + MO2-ndst1a + MO4-tp53	standard conditions	Fig. 6 from Filipek-Górniok et al., 2015
pectoral fin decreased length, abnormal	WT + MO2-ndst1a + MO4-tp53	standard conditions	Fig. 6 from Filipek-Górniok et al., 2015
head decreased size, abnormal	WT + MO2-ndst1a + MO4-tp53	standard conditions	Fig. 6 from Filipek-Górniok et al., 2015
pharyngeal arch cartilage malformed, abnormal	y1Tg + MO2-ndst1a + MO4-tp53	standard conditions	Fig. 6 from Filipek-Górniok et al., 2015
ceratohyal bone mislocalised, abnormal	y1Tg + MO2-ndst1a + MO4-tp53	standard conditions	Fig. 6 from Filipek-Górniok et al., 2015
basihyal cartilage decreased size, abnormal	y1Tg + MO2-ndst1a + MO4-tp53	standard conditions	Fig. 6 from Filipek-Górniok et al., 2015
pharyngeal arch 3-7 skeleton decreased size, abnormal	y1Tg + MO2-ndst1a + MO4-tp53	standard conditions	Fig. 6 from Filipek-Górniok et al., 2015

Citations