Morpholino

MO1-tmem132e

ID

ZDB-MRPHLNO-150413-1

Name

MO1-tmem132e

Previous Names

I2/E3 junction (1)

Target

tmem132e (1)

Sequence

5' - TTTTACCCTGTGAAAGAGACACAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tmem132e

No data available

Phenotype

Phenotype resulting from MO1-tmem132e

Phenotype	Fish	Figures
auditory receptor cell decreased functionality, abnormal	TU + MO1-tmem132e	Fig. 3 from Li et al., 2015
posterior lateral line neuromast absent, abnormal	TU + MO1-tmem132e	Fig. 4 from Li et al., 2015
posterior lateral line neuromast decreased functionality, abnormal	TU + MO1-tmem132e	Fig. 4 from Li et al., 2015
posterior lateral line neuromast morphology, abnormal	TU + MO1-tmem132e	Fig. 4 from Li et al., 2015
posterior lateral line neuromast kinocilium decreased amount, abnormal	TU + MO1-tmem132e	Fig. 4 from Li et al., 2015
posterior lateral line neuromast kinocilium decreased length, abnormal	TU + MO1-tmem132e	Fig. 4 from Li et al., 2015
posterior lateral line neuromast stereocilium decreased amount, abnormal	TU + MO1-tmem132e	Fig. 4 from Li et al., 2015
posterior lateral line neuromast stereocilium decreased length, abnormal	TU + MO1-tmem132e	Fig. 4 from Li et al., 2015
sensory perception of mechanical stimulus disrupted, abnormal	TU + MO1-tmem132e	Fig. 3 from Li et al., 2015
sensory perception of sound disrupted, abnormal	TU + MO1-tmem132e	Fig. 3 from Li et al., 2015
startle response delayed, abnormal	TU + MO1-tmem132e	Fig. 3 from Li et al., 2015
swimming behavior process quality, abnormal	TU + MO1-tmem132e	Fig. 3 from Li et al., 2015

Phenotype of all Fish created by or utilizing MO1-tmem132e

Phenotype	Fish	Conditions	Figures
posterior lateral line neuromast kinocilium decreased amount, abnormal	TU + MO1-tmem132e	standard conditions	Fig. 4 from Li et al., 2015
posterior lateral line neuromast kinocilium decreased length, abnormal	TU + MO1-tmem132e	standard conditions	Fig. 4 from Li et al., 2015
posterior lateral line neuromast absent, abnormal	TU + MO1-tmem132e	standard conditions	Fig. 4 from Li et al., 2015
sensory perception of sound disrupted, abnormal	TU + MO1-tmem132e	standard conditions	Fig. 3 from Li et al., 2015
posterior lateral line neuromast morphology, abnormal	TU + MO1-tmem132e	standard conditions	Fig. 4 from Li et al., 2015
sensory perception of mechanical stimulus disrupted, abnormal	TU + MO1-tmem132e	standard conditions	Fig. 3 from Li et al., 2015
posterior lateral line neuromast stereocilium decreased amount, abnormal	TU + MO1-tmem132e	standard conditions	Fig. 4 from Li et al., 2015
swimming behavior process quality, abnormal	TU + MO1-tmem132e	standard conditions	Fig. 3 from Li et al., 2015
posterior lateral line neuromast stereocilium decreased length, abnormal	TU + MO1-tmem132e	standard conditions	Fig. 4 from Li et al., 2015
posterior lateral line neuromast decreased functionality, abnormal	TU + MO1-tmem132e	standard conditions	Fig. 4 from Li et al., 2015
startle response delayed, abnormal	TU + MO1-tmem132e	standard conditions	Fig. 3 from Li et al., 2015
auditory receptor cell decreased functionality, abnormal	TU + MO1-tmem132e	standard conditions	Fig. 3 from Li et al., 2015

Citations