Morpholino
MO2-cul4b
- ID
- ZDB-MRPHLNO-150402-13
- Name
- MO2-cul4b
- Previous Names
-
- cul4b-MO2 (1)
- Target
- Sequence
-
5' - TCGCTAATCTACTAATGCTACGATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO, targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cul4b
No data available
Phenotype
Phenotype resulting from MO2-cul4b
Phenotype of all Fish created by or utilizing MO2-cul4b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| forebrain primary neuron ab1-tuba labeling decreased amount, abnormal | WT + MO2-cul4b | control |
Fig. 2 
from Ando et al., 2019 |
| head decreased size, abnormal | WT + MO2-cul4b | control |
Fig. 2
from Ando et al., 2019 |
| head decreased size, abnormal | WT + MO1-cul4a + MO2-cul4b | control |
Fig. 2
from Ando et al., 2019 |
| forebrain primary neuron ab1-tuba labeling decreased amount, abnormal | WT + MO1-cul4a + MO2-cul4b | control |
Fig. 2
from Ando et al., 2019 |
Citations
- Ando, H., Sato, T., Ito, T., Yamamoto, J., Sakamoto, S., Nitta, N., Asatsuma-Okumura, T., Shimizu, N., Mizushima, R., Aoki, I., Imai, T., Yamaguchi, Y., Berk, A.J., Handa, H. (2019) Cereblon Control of Zebrafish Brain Size by Regulation of Neural Stem Cell Proliferation. iScience. 15:95-108
- Yang, F., Hu, H., Liu, Y., Shao, M., Shao, C., Gong, Y. (2019) Cul4a promotes zebrafish primitive erythropoiesis via upregulating scl and gata1 expression. Cell Death & Disease. 10:388
- Zhao, X., Jiang, B., Hu, H., Mao, F., Mi, J., Li, Z., Liu, Q., Shao, C., Gong, Y. (2015) Zebrafish cul4a, but not cul4b, modulates cardiac and forelimb development by upregulating tbx5a expression. Human molecular genetics. 24(3):853-64
1 - 3 of 3
Show