Morpholino

MO1-ldlra

ID

ZDB-MRPHLNO-150312-1

Name

MO1-ldlra

Previous Names

None

Target

ldlra (1)

Sequence

5' - AGATCACATTTCATTTCTTACAGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ldlra

Expressed Gene	Anatomy	Figures
abca1b	whole organism	Fig. S6 from O'Hare et al., 2014
hmgcra	whole organism	Fig. S6 from O'Hare et al., 2014
ldlra	whole organism	Fig. 1 from O'Hare et al., 2014
pcsk9	(not) whole organism	Fig. S6 from O'Hare et al., 2014
srebf2	whole organism	Fig. S6 from O'Hare et al., 2014

Phenotype

Phenotype resulting from MO1-ldlra

Phenotype	Fish	Figures
caudal vein cholesterol increased amount, abnormal	TU + MO1-ldlra	Fig. 3 from Montasser et al., 2018
cholesterol homeostasis process quality, abnormal	WT + MO1-ldlra	Fig. 2, Fig. 3, Fig. S6 from O'Hare et al., 2014
liver fatty, abnormal	WT + MO1-ldlra	Fig. S7 from O'Hare et al., 2014
liver increased size, abnormal	WT + MO1-ldlra	Fig. S7 from O'Hare et al., 2014
posterior cardinal vein fatty, abnormal	WT + MO1-ldlra	Fig. 3 from O'Hare et al., 2014
posterior cardinal vein vascular endothelium increased permeability, abnormal	WT + MO1-ldlra	Fig. 5 from O'Hare et al., 2014
whole organism low-density lipoprotein cholesterol increased amount, abnormal	TU + MO1-ldlra	Fig. 3 from Montasser et al., 2018

Phenotype of all Fish created by or utilizing MO1-ldlra

Phenotype	Fish	Conditions	Figures
caudal vein cholesterol increased amount, abnormal	TU + MO1-ldlra	control	Fig. 3 from Montasser et al., 2018
whole organism low-density lipoprotein cholesterol increased amount, abnormal	TU + MO1-ldlra	control	Fig. 3 from Montasser et al., 2018
caudal vein cholesterol increased amount, abnormal	TU + MO1-ldlra	high cholesterol	Fig. 3 from Montasser et al., 2018
whole organism low-density lipoprotein cholesterol increased amount, abnormal	TU + MO1-ldlra	high cholesterol	Fig. 3 from Montasser et al., 2018
liver increased size, abnormal	WT + MO1-ldlra	standard conditions	Fig. S7 from O'Hare et al., 2014
posterior cardinal vein vascular endothelium increased permeability, abnormal	WT + MO1-ldlra	high cholesterol	Fig. 5 from O'Hare et al., 2014
liver fatty, abnormal	WT + MO1-ldlra	high cholesterol	Fig. S7 from O'Hare et al., 2014
posterior cardinal vein fatty, abnormal	WT + MO1-ldlra	high cholesterol	Fig. 3 from O'Hare et al., 2014
posterior cardinal vein fatty, abnormal	WT + MO1-ldlra	standard conditions	Fig. 3 from O'Hare et al., 2014
cholesterol homeostasis process quality, abnormal	WT + MO1-ldlra	standard conditions	Fig. 2, Fig. 3, Fig. S6 from O'Hare et al., 2014
vasculature macrophage mislocalised, abnormal	WT + MO1-ldlra	high cholesterol	Fig. 4 from O'Hare et al., 2014
liver fatty, abnormal	WT + MO1-ldlra	standard conditions	Fig. S7 from O'Hare et al., 2014
posterior cardinal vein fatty, abnormal	WT + MO1-ldlra	high cholesterol, chemical treatment: atorvastatin	Fig. 3 from O'Hare et al., 2014
posterior cardinal vein has extra parts of type macrophage, abnormal	WT + MO1-ldlra	high cholesterol	Fig. 4 from O'Hare et al., 2014
posterior cardinal vein vascular endothelium increased permeability, abnormal	WT + MO1-ldlra	standard conditions	Fig. 5 from O'Hare et al., 2014
cholesterol homeostasis process quality, abnormal	WT + MO1-ldlra	high cholesterol, chemical treatment: atorvastatin	Fig. 3 from O'Hare et al., 2014
liver increased size, abnormal	WT + MO1-ldlra	high cholesterol	Fig. S7 from O'Hare et al., 2014
cholesterol homeostasis process quality, abnormal	WT + MO1-ldlra	high cholesterol	Fig. 2, Fig. 3 from O'Hare et al., 2014
posterior cardinal vein lipid oxidation increased occurrence, abnormal	sd16Tg + MO1-ldlra	heat shock	Fig. 4 from O'Hare et al., 2014
posterior cardinal vein lipid oxidation increased occurrence, abnormal	sd16Tg + MO1-ldlra	high cholesterol, heat shock	Fig. 4 from O'Hare et al., 2014

Citations