Morpholino

MO1-prmt6

ID
ZDB-MRPHLNO-141215-14
Name
MO1-prmt6
Previous Names
None
Target
Sequence
5' - GGCCATGCGTCTTTAGTTTTTCCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prmt6
No data available
Phenotype
Phenotype resulting from MO1-prmt6
Phenotype Fish Figures
apoptotic process process quality, abnormal AB + MO1-prmt6 Fig. 4 from Zhao et al., 2016
epiboly process quality, abnormal AB + MO1-prmt6 Fig. 2Fig. 3Fig. 4 from Zhao et al., 2016
whole organism ab12-tp53 labeling amount, ameliorated AB + MO1-prmt6 + MO4-tp53 Fig. 2 from Zhao et al., 2016
whole organism eve1 expression decreased amount, abnormal AB + MO1-prmt6 Fig. 3 from Zhao et al., 2016
whole organism Ab43-h3 labeling decreased amount, abnormal AB + MO1-prmt6 Fig. 2 from Zhao et al., 2016
whole organism sox2 expression decreased amount, abnormal AB + MO1-prmt6 Fig. 3 from Zhao et al., 2016
whole organism hsp70.3 expression increased amount, abnormal AB + MO1-prmt6 Fig. 3 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO1-prmt6 Fig. 3Fig. 4 from Zhao et al., 2016
whole organism tp53 expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 Fig. 4 from Zhao et al., 2016
whole organism cdkn1a expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 Fig. 4 from Zhao et al., 2016
whole organism rx3 expression increased amount, abnormal AB + MO1-prmt6 Fig. 3 from Zhao et al., 2016
whole organism tbpl2 expression increased amount, abnormal AB + MO1-prmt6 Fig. 3 from Zhao et al., 2016
whole organism jun expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 Fig. 4 from Zhao et al., 2016
whole organism ab12-tp53 labeling increased amount, abnormal AB + MO1-prmt6 Fig. 2 from Zhao et al., 2016
Phenotype of all Fish created by or utilizing MO1-prmt6
Phenotype Fish Conditions Figures
whole organism sox2 expression decreased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 3 from Zhao et al., 2016
whole organism ab12-tp53 labeling increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 2 from Zhao et al., 2016
epiboly process quality, abnormal AB + MO1-prmt6 standard conditions Fig. 2Fig. 3Fig. 4 from Zhao et al., 2016
whole organism rx3 expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 3 from Zhao et al., 2016
epiboly process quality, ameliorated AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one, chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
whole organism tp53 expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 4 from Zhao et al., 2016
whole organism jun expression amount, ameliorated AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one, chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
apoptotic process process quality, ameliorated AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one, chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
whole organism cdkn1a expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 4 from Zhao et al., 2016
epiboly process quality, ameliorated AB + MO1-prmt6 chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 3Fig. 4 from Zhao et al., 2016
whole organism eve1 expression decreased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 3 from Zhao et al., 2016
whole organism jun expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 4 from Zhao et al., 2016
whole organism tbpl2 expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 3 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one, chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
epiboly process quality, ameliorated AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one Fig. 4 from Zhao et al., 2016
whole organism cdkn1a expression amount, ameliorated AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one, chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
whole organism hsp70.3 expression increased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 3 from Zhao et al., 2016
whole organism tp53 expression amount, ameliorated AB + MO1-prmt6 chemical treatment by injection: anthra[1,9-cd]pyrazol-6(2H)-one, chemical treatment by injection: SB 203580 Fig. 4 from Zhao et al., 2016
apoptotic process process quality, abnormal AB + MO1-prmt6 standard conditions Fig. 4 from Zhao et al., 2016
whole organism Ab43-h3 labeling decreased amount, abnormal AB + MO1-prmt6 standard conditions Fig. 2 from Zhao et al., 2016
epiboly process quality, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
apoptotic process process quality, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism tp53 expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism cdkn1a expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
whole organism ab12-tp53 labeling amount, ameliorated AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 2 from Zhao et al., 2016
whole organism jun expression increased amount, abnormal AB + MO1-prmt6 + MO4-tp53 standard conditions Fig. 4 from Zhao et al., 2016
epiboly process quality, abnormal AB + MO1-hsp70l + MO1-prmt6 standard conditions Fig. 3 from Zhao et al., 2016
epiboly process quality, abnormal AB + MO1-prmt6 + MO2-tbpl2 standard conditions Fig. 3 from Zhao et al., 2016
epiboly process quality, ameliorated AB + MO1-prmt6 + MO3-gadd45aa standard conditions Fig. 3 from Zhao et al., 2016
whole organism cdkn1a expression amount, ameliorated AB + MO1-prmt6 + MO3-gadd45aa standard conditions Fig. 4 from Zhao et al., 2016
apoptotic process process quality, ameliorated AB + MO1-prmt6 + MO3-gadd45aa standard conditions Fig. 4 from Zhao et al., 2016
whole organism gadd45aa expression increased amount, abnormal AB + MO1-prmt6 + MO3-gadd45aa standard conditions Fig. 4 from Zhao et al., 2016
whole organism jun expression amount, ameliorated AB + MO1-prmt6 + MO3-gadd45aa standard conditions Fig. 4 from Zhao et al., 2016
whole organism tp53 expression amount, ameliorated AB + MO1-prmt6 + MO3-gadd45aa standard conditions Fig. 4 from Zhao et al., 2016
Citations