Morpholino
MO1-cicb
- ID
- ZDB-MRPHLNO-141211-16
- Name
- MO1-cicb
- Previous Names
- None
- Target
- Sequence
-
5' - CAGTAGACCACTCACGGATCATCCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cicb
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| gata1a |
Fig. 4
from Huang et al., 2013 |
|
| hbbe3 |
Fig. 4
from Huang et al., 2013 |
|
| myod1 |
Fig. 4
from Huang et al., 2013 |
|
| tal1 |
Fig. 4
from Huang et al., 2013 |
Phenotype
Phenotype resulting from MO1-cicb
Phenotype of all Fish created by or utilizing MO1-cicb
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| erythroid lineage cell hbbe3 expression increased amount, abnormal | TU + MO1-cicb | control |
Fig. 4
from Huang et al., 2013 |
| erythroid progenitor cell gata1a expression increased amount, abnormal | TU + MO1-cicb | control |
Fig. 4
from Huang et al., 2013 |
| mesoderm tal1 expression increased amount, abnormal | TU + MO1-cicb | control |
Fig. 4
from Huang et al., 2013 |
| primitive erythrocyte differentiation increased occurrence, abnormal | TU + MO1-cicb | control |
Fig. 4
from Huang et al., 2013 |
Citations