Morpholino

MO1-mcc

ID
ZDB-MRPHLNO-141210-1
Name
MO1-mcc
Previous Names
None
Target
Sequence
5' - CCACCGCCACTGCCGCCGCCATTTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
ATG morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mcc
Expressed Gene Anatomy Figures
ctslb Fig. 2 with image from Young et al., 2014
dlx3b Fig. 2 with image from Young et al., 2014
tbxta Fig. 2 with image from Young et al., 2014
Phenotype
Phenotype resulting from MO1-mcc
Phenotype Fish Figures
ectoderm cell orientation ectoderm, abnormal WT + MO1-mcc Fig. 3 with image from Young et al., 2014
ectoderm cell shape, abnormal WT + MO1-mcc Fig. 3 with image from Young et al., 2014
extension decreased length, abnormal WT + MO1-mcc Fig. 2 with image from Young et al., 2014
eye decreased size, abnormal WT + MO1-mcc Fig. 2 with image from Young et al., 2014
head decreased size, abnormal WT + MO1-mcc Fig. 2 with image from Young et al., 2014
head malformed, abnormal WT + MO1-mcc Fig. 2 with image from Young et al., 2014
notochord cell orientation notochord, abnormal WT + MO1-mcc Fig. 3 with image from Young et al., 2014
notochord cell shape, abnormal WT + MO1-mcc Fig. 3 with image from Young et al., 2014
somite condensed, abnormal WT + MO1-mcc Fig. 2 with image from Young et al., 2014
whole organism curved ventral, abnormal WT + MO1-mcc Fig. 2 with image from Young et al., 2014
whole organism decreased length, abnormal WT + MO1-mcc Fig. 2 with image from Young et al., 2014
Phenotype of all Fish created by or utilizing MO1-mcc
Phenotype Fish Conditions Figures
head decreased size, abnormal WT + MO1-mcc standard conditions Fig. 2 with image from Young et al., 2014
extension decreased length, abnormal WT + MO1-mcc standard conditions Fig. 2 with image from Young et al., 2014
ectoderm cell orientation ectoderm, abnormal WT + MO1-mcc standard conditions Fig. 3 with image from Young et al., 2014
ectoderm cell shape, abnormal WT + MO1-mcc standard conditions Fig. 3 with image from Young et al., 2014
notochord cell orientation notochord, abnormal WT + MO1-mcc standard conditions Fig. 3 with image from Young et al., 2014
notochord cell shape, abnormal WT + MO1-mcc standard conditions Fig. 3 with image from Young et al., 2014
head malformed, abnormal WT + MO1-mcc standard conditions Fig. 2 with image from Young et al., 2014
whole organism decreased length, abnormal WT + MO1-mcc standard conditions Fig. 2 with image from Young et al., 2014
somite condensed, abnormal WT + MO1-mcc standard conditions Fig. 2 with image from Young et al., 2014
whole organism curved ventral, abnormal WT + MO1-mcc standard conditions Fig. 2 with image from Young et al., 2014
eye decreased size, abnormal WT + MO1-mcc standard conditions Fig. 2 with image from Young et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.