Morpholino
MO2-jam2a
- ID
- ZDB-MRPHLNO-141111-5
- Name
- MO2-jam2a
- Previous Names
-
- MOex5 (1)
- Target
- Sequence
-
5' - AGGAACTACAGCAGAAACAGGTCAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-jam2a
No data available
Phenotype
Phenotype resulting from MO2-jam2a
| Phenotype | Fish | Figures |
|---|---|---|
| posterior lateral mesoderm cell shape, abnormal | hzm7Et; y1Tg + MO2-jam2a |
Fig. S5
from Kobayashi et al., 2014 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-jam2a
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| posterior lateral mesoderm cell shape, abnormal | hzm7Et; y1Tg + MO2-jam2a | standard conditions |
Fig. S5
from Kobayashi et al., 2014 |
1 - 1 of 1
Citations
- Kobayashi, I., Kobayashi-Sun, J., Hirakawa, Y., Ouchi, M., Yasuda, K., Kamei, H., Fukuhara, S., Yamaguchi, M. (2019) Dual role of Jam3b in early hematopoietic and vascular development. Development (Cambridge, England). 147(1):
- Kobayashi, I., Kobayashi-Sun, J., Kim, A.D., Pouget, C., Fujita, N., Suda, T., Traver, D. (2014) Jam1a-Jam2a interactions regulate haematopoietic stem cell fate through Notch signalling. Nature. 512(7514):319-23
1 - 2 of 2
Show