Morpholino
MO1-ror2
- ID
- ZDB-MRPHLNO-141022-3
- Name
- MO1-ror2
- Previous Names
- None
- Target
- Sequence
-
5' - CAGTGTAACAACTTCCAAACTCTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO, targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ror2
No data available
Phenotype
Phenotype resulting from MO1-ror2
Phenotype | Fish | Figures |
---|---|---|
convergent extension involved in axis elongation process quality, abnormal | AB + MO1-ror2 |
Fig. 3 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-ror2
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
convergent extension involved in axis elongation process quality, abnormal | AB + MO1-ror2 | control |
Fig. 3 ![]() |
1 - 1 of 1
Citations
- Mattes, B., Dang, Y., Greicius, G., Kaufmann, L.T., Prunsche, B., Rosenbauer, J., Stegmaier, J., Mikut, R., Özbek, S., Nienhaus, G.U., Schug, A., Virshup, D.M., Scholpp, S. (2018) Wnt/PCP controls spreading of Wnt/β-catenin signals by cytonemes in vertebrates. eLIFE. 7:
- Bai, Y., Tan, X., Zhang, H., Liu, C., Zhao, B., Li, Y., Lu, L., Liu, Y., Zhou, J. (2014) Ror2 Receptor Mediates Wnt11 Signaling and Affects Convergence and Extension Movements in Zebrafish. The Journal of biological chemistry. 289(30):20664-20676
1 - 2 of 2
Show