Morpholino

MO1-gria2a

ID
ZDB-MRPHLNO-140924-7
Name
MO1-gria2a
Previous Names
  • QRMO (1)
Target
Sequence
5' - TATGCAGCCGAAACACGGTACCACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This morpholino was designed to complement the sequence of exon complementary sequence (ECS) and was used to block the Q/R editing of gria2a.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gria2a
No data available
Phenotype
Phenotype resulting from MO1-gria2a
Phenotype Fish Figures
anterior lateral line neuromast decreased amount, abnormal WT + MO1-gria2a Fig. 6 with image from Li et al., 2014
apoptotic process increased process quality, abnormal WT + MO1-gria2a Fig. 4 with image from Li et al., 2014
cranial cartilage malformed, abnormal WT + MO1-gria2a + MO4-tp53 Fig. 7 with image from Li et al., 2014
ethmoid cartilage absent, abnormal WT + MO1-gria2a + MO4-tp53 Fig. 7 with image from Li et al., 2014
eye apoptotic process increased process quality, abnormal WT + MO1-gria2a Fig. 4 with image from Li et al., 2014
fourth ventricle increased size, abnormal WT + MO1-gria2a Fig. 3 with image from Li et al., 2014
head decreased size, abnormal WT + MO1-gria2a Fig. 3 with image from Li et al., 2014
head apoptotic process increased process quality, abnormal WT + MO1-gria2a Fig. 4 with image from Li et al., 2014
hindbrain apoptotic process increased process quality, abnormal WT + MO1-gria2a Fig. 4 with image from Li et al., 2014
horizontal myoseptum apoptotic process increased process quality, abnormal WT + MO1-gria2a Fig. 4 with image from Li et al., 2014
midbrain apoptotic process increased process quality, abnormal WT + MO1-gria2a Fig. 4 with image from Li et al., 2014
neural crest cell migration process quality, abnormal WT + MO1-gria2a Fig. 8 with image from Li et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-gria2a + MO4-tp53 Fig. 7 with image from Li et al., 2014
parachordal cartilage decreased size, abnormal WT + MO1-gria2a + MO4-tp53 Fig. 7 with image from Li et al., 2014
pharyngeal arch absent, abnormal WT + MO1-gria2a + MO4-tp53 Fig. 7 with image from Li et al., 2014
posterior lateral line neuromast decreased amount, abnormal WT + MO1-gria2a Fig. 6 with image from Li et al., 2014
spinal cord has fewer parts of type motor neuron, abnormal rw0Tg + MO1-gria2a (AB) Fig. 6 with image from Li et al., 2014
third ventricle increased size, abnormal WT + MO1-gria2a Fig. 3 with image from Li et al., 2014
trunk apoptotic process increased process quality, abnormal WT + MO1-gria2a Fig. 4 with image from Li et al., 2014
Phenotype of all Fish created by or utilizing MO1-gria2a
Phenotype Fish Conditions Figures
ethmoid cartilage absent, abnormal WT + MO1-gria2a standard conditions Fig. 7 with image from Li et al., 2014
anterior lateral line neuromast decreased amount, abnormal WT + MO1-gria2a standard conditions Fig. 6 with image from Li et al., 2014
apoptotic process increased process quality, abnormal WT + MO1-gria2a standard conditions Fig. 4 with image from Li et al., 2014
third ventricle increased size, abnormal WT + MO1-gria2a standard conditions Fig. 3 with image from Li et al., 2014
fourth ventricle increased size, abnormal WT + MO1-gria2a standard conditions Fig. 3 with image from Li et al., 2014
trunk apoptotic process increased process quality, abnormal WT + MO1-gria2a standard conditions Fig. 4 with image from Li et al., 2014
hindbrain apoptotic process increased process quality, abnormal WT + MO1-gria2a standard conditions Fig. 4 with image from Li et al., 2014
head apoptotic process increased process quality, abnormal WT + MO1-gria2a standard conditions Fig. 4 with image from Li et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-gria2a standard conditions Fig. 7 with image from Li et al., 2014
posterior lateral line neuromast decreased amount, abnormal WT + MO1-gria2a standard conditions Fig. 6 with image from Li et al., 2014
head decreased size, abnormal WT + MO1-gria2a standard conditions Fig. 3 with image from Li et al., 2014
pharyngeal arch absent, abnormal WT + MO1-gria2a standard conditions Fig. 7 with image from Li et al., 2014
midbrain apoptotic process increased process quality, abnormal WT + MO1-gria2a standard conditions Fig. 4 with image from Li et al., 2014
eye apoptotic process increased process quality, abnormal WT + MO1-gria2a standard conditions Fig. 4 with image from Li et al., 2014
parachordal cartilage decreased size, abnormal WT + MO1-gria2a standard conditions Fig. 7 with image from Li et al., 2014
cranial cartilage malformed, abnormal WT + MO1-gria2a standard conditions Fig. 7 with image from Li et al., 2014
neural crest cell migration process quality, abnormal WT + MO1-gria2a standard conditions Fig. 8 with image from Li et al., 2014
horizontal myoseptum apoptotic process increased process quality, abnormal WT + MO1-gria2a standard conditions Fig. 4 with image from Li et al., 2014
ethmoid cartilage absent, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
posterior lateral line neuromast decreased amount, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 6 with image from Li et al., 2014
cranial cartilage malformed, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
parachordal cartilage decreased size, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
pharyngeal arch absent, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
anterior lateral line neuromast decreased amount, abnormal WT + MO1-gria2a + MO4-tp53 standard conditions Fig. 6 with image from Li et al., 2014
spinal cord has fewer parts of type motor neuron, abnormal rw0Tg + MO1-gria2a (AB) standard conditions Fig. 6 with image from Li et al., 2014
third ventricle increased size, abnormal tp53zdf1/zdf1 + MO1-gria2a standard conditions Fig. 3 with image from Li et al., 2014
fourth ventricle increased size, abnormal tp53zdf1/zdf1 + MO1-gria2a standard conditions Fig. 3 with image from Li et al., 2014
head decreased size, abnormal tp53zdf1/zdf1 + MO1-gria2a standard conditions Fig. 3 with image from Li et al., 2014
neural crest cell migration process quality, abnormal tp53zdf1/zdf1 + MO1-gria2a standard conditions Fig. 8 with image from Li et al., 2014
Citations