Morpholino

MO1-adarb1a

ID
ZDB-MRPHLNO-140924-5
Name
MO1-adarb1a
Previous Names
None
Target
Sequence
5' - GAAGACGTATGCGGTAAATGGCGAAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adarb1a
No data available
Phenotype
Phenotype resulting from MO1-adarb1a
Phenotype Fish Figures
anterior lateral line neuromast decreased amount, abnormal WT + MO1-adarb1a + MO4-tp53 Fig. 6 with image from Li et al., 2014
apoptotic process increased process quality, abnormal WT + MO1-adarb1a Fig. 4 with image from Li et al., 2014
cranial cartilage malformed, abnormal WT + MO1-adarb1a + MO4-tp53 Fig. 7 with image from Li et al., 2014
ethmoid cartilage absent, abnormal WT + MO1-adarb1a + MO4-tp53 Fig. 7 with image from Li et al., 2014
eye apoptotic process increased process quality, abnormal WT + MO1-adarb1a Fig. 4 with image from Li et al., 2014
fourth ventricle increased size, abnormal WT + MO1-adarb1a + MO4-tp53 Fig. 3 with image from Li et al., 2014
head decreased size, abnormal WT + MO1-adarb1a Fig. 3 with image from Li et al., 2014
head apoptotic process increased process quality, abnormal WT + MO1-adarb1a Fig. 4 with image from Li et al., 2014
hindbrain apoptotic process increased process quality, abnormal WT + MO1-adarb1a Fig. 4 with image from Li et al., 2014
horizontal myoseptum apoptotic process increased process quality, abnormal WT + MO1-adarb1a Fig. 4 with image from Li et al., 2014
midbrain apoptotic process increased process quality, abnormal WT + MO1-adarb1a Fig. 4 with image from Li et al., 2014
neural crest cell migration process quality, abnormal WT + MO1-adarb1a Fig. 8 with image from Li et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-adarb1a + MO4-tp53 Fig. 7 with image from Li et al., 2014
parachordal cartilage decreased size, abnormal WT + MO1-adarb1a Fig. 7 with image from Li et al., 2014
pharyngeal arch absent, abnormal WT + MO1-adarb1a + MO4-tp53 Fig. 7 with image from Li et al., 2014
posterior lateral line neuromast decreased amount, abnormal WT + MO1-adarb1a Fig. 6 with image from Li et al., 2014
spinal cord has fewer parts of type motor neuron, abnormal rw0Tg + MO1-adarb1a (AB) Fig. 6 with image from Li et al., 2014
third ventricle increased size, abnormal WT + MO1-adarb1a + MO4-tp53 Fig. 3 with image from Li et al., 2014
trunk apoptotic process increased process quality, abnormal WT + MO1-adarb1a Fig. 4 with image from Li et al., 2014
Phenotype of all Fish created by or utilizing MO1-adarb1a
Phenotype Fish Conditions Figures
neural crest cell migration process quality, abnormal WT + MO1-adarb1a standard conditions Fig. 8 with image from Li et al., 2014
fourth ventricle increased size, abnormal WT + MO1-adarb1a standard conditions Fig. 3 with image from Li et al., 2014
midbrain apoptotic process increased process quality, abnormal WT + MO1-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
apoptotic process increased process quality, abnormal WT + MO1-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
head decreased size, abnormal WT + MO1-adarb1a standard conditions Fig. 3 with image from Li et al., 2014
posterior lateral line neuromast decreased amount, abnormal WT + MO1-adarb1a standard conditions Fig. 6 with image from Li et al., 2014
cranial cartilage malformed, abnormal WT + MO1-adarb1a standard conditions Fig. 7 with image from Li et al., 2014
hindbrain apoptotic process increased process quality, abnormal WT + MO1-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
trunk apoptotic process increased process quality, abnormal WT + MO1-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-adarb1a standard conditions Fig. 7 with image from Li et al., 2014
third ventricle increased size, abnormal WT + MO1-adarb1a standard conditions Fig. 3 with image from Li et al., 2014
horizontal myoseptum apoptotic process increased process quality, abnormal WT + MO1-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
anterior lateral line neuromast decreased amount, abnormal WT + MO1-adarb1a standard conditions Fig. 6 with image from Li et al., 2014
pharyngeal arch absent, abnormal WT + MO1-adarb1a standard conditions Fig. 7 with image from Li et al., 2014
head apoptotic process increased process quality, abnormal WT + MO1-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
parachordal cartilage decreased size, abnormal WT + MO1-adarb1a standard conditions Fig. 7 with image from Li et al., 2014
eye apoptotic process increased process quality, abnormal WT + MO1-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
ethmoid cartilage absent, abnormal WT + MO1-adarb1a standard conditions Fig. 7 with image from Li et al., 2014
cranial cartilage malformed, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
ethmoid cartilage absent, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
fourth ventricle increased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
third ventricle increased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
head decreased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
pharyngeal arch absent, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
parachordal cartilage decreased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
posterior lateral line neuromast decreased amount, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 6 with image from Li et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 7 with image from Li et al., 2014
anterior lateral line neuromast decreased amount, abnormal WT + MO1-adarb1a + MO4-tp53 standard conditions Fig. 6 with image from Li et al., 2014
spinal cord has fewer parts of type motor neuron, abnormal rw0Tg + MO1-adarb1a (AB) standard conditions Fig. 6 with image from Li et al., 2014
neural crest cell migration process quality, abnormal tp53zdf1/zdf1 + MO1-adarb1a standard conditions Fig. 8 with image from Li et al., 2014
head decreased size, abnormal tp53zdf1/zdf1 + MO1-adarb1a standard conditions Fig. 3 with image from Li et al., 2014
fourth ventricle increased size, abnormal tp53zdf1/zdf1 + MO1-adarb1a standard conditions Fig. 3 with image from Li et al., 2014
third ventricle increased size, abnormal tp53zdf1/zdf1 + MO1-adarb1a standard conditions Fig. 3 with image from Li et al., 2014
Citations