Morpholino

MO2-rtn4b

ID
ZDB-MRPHLNO-140923-6
Name
MO2-rtn4b
Previous Names
  • rtn4b MO-1 (1)
Target
Sequence
5' - CCACTGCGGGAGAACTCAGAACAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rtn4b
No data available
Phenotype
Phenotype resulting from MO2-rtn4b
Phenotype Fish Figures
brain decreased size, abnormal WT + MO2-rtn4b Fig. 4 with imageFig. 7 with image from Pinzón-Olejua et al., 2014
caudal fin curved ventral, abnormal WT + MO2-rtn4b Fig. 4 with image from Pinzón-Olejua et al., 2014
caudal fin decreased thickness, abnormal WT + MO2-rtn4b Fig. 4 with image from Pinzón-Olejua et al., 2014
cranial nerve II has fewer parts of type retinal ganglion cell axon, abnormal WT + MO2-rtn4b Fig. 6 with image from Pinzón-Olejua et al., 2014
cranial nerve II immature, abnormal t10Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
cranial nerve III absent, abnormal rw0Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
cranial nerve IV absent, abnormal rw0Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
dorsal thalamus deformed, abnormal t10Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
eye decreased size, abnormal WT + MO2-rtn4b Fig. 4 with imageFig. 5 with image from Pinzón-Olejua et al., 2014
floor plate anterior region deformed, abnormal t10Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
forebrain decreased size, abnormal WT + MO2-rtn4b Fig. 7 with image from Pinzón-Olejua et al., 2014
forebrain deformed, abnormal t10Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
forebrain flattened, abnormal WT + MO2-rtn4b Fig. 4 with image from Pinzón-Olejua et al., 2014
fourth ventricle deformed, abnormal WT + MO2-rtn4b Fig. 4 with image from Pinzón-Olejua et al., 2014
head altered number of neuromast, abnormal s356tTg + MO2-rtn4b Fig. 7 with image from Pinzón-Olejua et al., 2014
head decreased size, abnormal WT + MO2-rtn4b Fig. 4 with image from Pinzón-Olejua et al., 2014
hypothalamus deformed, abnormal t10Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
immature eye decreased size, abnormal WT + MO2-rtn4b Fig. 4 with image from Pinzón-Olejua et al., 2014
motor neuron axon guidance process quality, abnormal ml2Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
neuromast displaced, abnormal s356tTg + MO2-rtn4b Fig. 7 with image from Pinzón-Olejua et al., 2014
notochord curved, abnormal WT + MO2-rtn4b Fig. 4 with image from Pinzón-Olejua et al., 2014
notochord undulate, abnormal t10Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
olfactory placode morphology, abnormal WT + MO2-rtn4b Fig. 7 with image from Pinzón-Olejua et al., 2014
optic tectum decreased size, abnormal WT + MO2-rtn4b Fig. 7 with image from Pinzón-Olejua et al., 2014
optic tectum has fewer parts of type retinal ganglion cell neuron projection, abnormal WT + MO2-rtn4b Fig. 7 with image from Pinzón-Olejua et al., 2014
optic tectum mislocalised anteriorly, abnormal WT + MO2-rtn4b Fig. 5 with imageFig. 7 with image from Pinzón-Olejua et al., 2014
pectoral fin aplastic/hypoplastic, abnormal t10Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
pericardial cavity inflated, abnormal WT + MO2-rtn4b Fig. 4 with image from Pinzón-Olejua et al., 2014
pharyngeal arch 3-7 absent, abnormal t10Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
retina has fewer parts of type retinal ganglion cell, abnormal WT + MO2-rtn4b Fig. 6 with image from Pinzón-Olejua et al., 2014
retinal ganglion cell immature, abnormal t10Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
retinal ganglion cell axon guidance process quality, abnormal s356tTg + MO2-rtn4b Fig. 6 with image from Pinzón-Olejua et al., 2014
retinal ganglion cell neuron projection immature, abnormal t10Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
spinal cord has fewer parts of type motor neuron, abnormal ml2Tg + MO2-rtn4b Fig. 5 with image from Pinzón-Olejua et al., 2014
ventral mandibular arch absent, abnormal t10Tg + MO2-rtn4b Fig. 4 with imageFig. 5 with image from Pinzón-Olejua et al., 2014
Phenotype of all Fish created by or utilizing MO2-rtn4b
Phenotype Fish Conditions Figures
immature eye decreased size, abnormal WT + MO2-rtn4b standard conditions Fig. 4 with image from Pinzón-Olejua et al., 2014
caudal fin decreased thickness, abnormal WT + MO2-rtn4b standard conditions Fig. 4 with image from Pinzón-Olejua et al., 2014
optic tectum has fewer parts of type retinal ganglion cell neuron projection, abnormal WT + MO2-rtn4b standard conditions Fig. 7 with image from Pinzón-Olejua et al., 2014
eye decreased size, abnormal WT + MO2-rtn4b standard conditions Fig. 4 with image from Pinzón-Olejua et al., 2014
optic tectum mislocalised anteriorly, abnormal WT + MO2-rtn4b standard conditions Fig. 7 with image from Pinzón-Olejua et al., 2014
retina has fewer parts of type retinal ganglion cell, abnormal WT + MO2-rtn4b standard conditions Fig. 6 with image from Pinzón-Olejua et al., 2014
cranial nerve II has fewer parts of type retinal ganglion cell axon, abnormal WT + MO2-rtn4b standard conditions Fig. 6 with image from Pinzón-Olejua et al., 2014
head decreased size, abnormal WT + MO2-rtn4b standard conditions Fig. 4 with image from Pinzón-Olejua et al., 2014
forebrain decreased size, abnormal WT + MO2-rtn4b standard conditions Fig. 7 with image from Pinzón-Olejua et al., 2014
ventral mandibular arch absent, abnormal WT + MO2-rtn4b standard conditions Fig. 4 with image from Pinzón-Olejua et al., 2014
optic tectum decreased size, abnormal WT + MO2-rtn4b standard conditions Fig. 7 with image from Pinzón-Olejua et al., 2014
forebrain flattened, abnormal WT + MO2-rtn4b standard conditions Fig. 4 with image from Pinzón-Olejua et al., 2014
notochord curved, abnormal WT + MO2-rtn4b standard conditions Fig. 4 with image from Pinzón-Olejua et al., 2014
retinal ganglion cell axon guidance process quality, abnormal WT + MO2-rtn4b standard conditions Fig. 6 with image from Pinzón-Olejua et al., 2014
cranial nerve II axon regeneration disrupted, abnormal WT + MO2-rtn4b transection: cranial nerve II Fig. 6 with image from Welte et al., 2015
olfactory placode morphology, abnormal WT + MO2-rtn4b standard conditions Fig. 7 with image from Pinzón-Olejua et al., 2014
fourth ventricle deformed, abnormal WT + MO2-rtn4b standard conditions Fig. 4 with image from Pinzón-Olejua et al., 2014
brain decreased size, abnormal WT + MO2-rtn4b standard conditions Fig. 4 with imageFig. 7 with image from Pinzón-Olejua et al., 2014
pericardial cavity inflated, abnormal WT + MO2-rtn4b standard conditions Fig. 4 with image from Pinzón-Olejua et al., 2014
caudal fin curved ventral, abnormal WT + MO2-rtn4b standard conditions Fig. 4 with image from Pinzón-Olejua et al., 2014
spinal cord has fewer parts of type motor neuron, abnormal ml2Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
motor neuron axon guidance process quality, abnormal ml2Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
cranial nerve IV absent, abnormal rw0Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
cranial nerve III absent, abnormal rw0Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
optic tectum has fewer parts of type retinal ganglion cell neuron projection, abnormal s356tTg + MO2-rtn4b standard conditions Fig. 7 with image from Pinzón-Olejua et al., 2014
retina has fewer parts of type retinal ganglion cell, abnormal s356tTg + MO2-rtn4b standard conditions Fig. 6 with image from Pinzón-Olejua et al., 2014
head altered number of neuromast, abnormal s356tTg + MO2-rtn4b standard conditions Fig. 7 with image from Pinzón-Olejua et al., 2014
neuromast displaced, abnormal s356tTg + MO2-rtn4b standard conditions Fig. 7 with image from Pinzón-Olejua et al., 2014
cranial nerve II has fewer parts of type retinal ganglion cell axon, abnormal s356tTg + MO2-rtn4b standard conditions Fig. 6 with image from Pinzón-Olejua et al., 2014
retinal ganglion cell axon guidance process quality, abnormal s356tTg + MO2-rtn4b standard conditions Fig. 6 with image from Pinzón-Olejua et al., 2014
pectoral fin aplastic/hypoplastic, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
ventral mandibular arch absent, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
dorsal thalamus deformed, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
hypothalamus deformed, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
cranial nerve II immature, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
retinal ganglion cell neuron projection immature, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
eye decreased size, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
forebrain deformed, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
retinal ganglion cell immature, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
pharyngeal arch 3-7 absent, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
optic tectum mislocalised anteriorly, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
floor plate anterior region deformed, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
notochord undulate, abnormal t10Tg + MO2-rtn4b standard conditions Fig. 5 with image from Pinzón-Olejua et al., 2014
Citations