Morpholino
MO1-vegfd
- ID
- ZDB-MRPHLNO-140903-1
- Name
- MO1-vegfd
- Previous Names
-
- MO1-figf
- vegfd MO, exon4/intron4 (1)
- Target
- Sequence
-
5' - CAAATGAATCCGATACTGACCTGTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-vegfd
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| mafba |
Fig. 4 
from Arnold et al., 2022 |
|
| mafbb |
Fig. 4
from Arnold et al., 2022 |
1 - 2 of 2
Phenotype
Phenotype resulting from MO1-vegfd
| Phenotype | Fish | Figures |
|---|---|---|
| facial lymphatic network lymphatic endothelial cluster EGFP expression decreased amount, abnormal | nz101Tg/nz101Tg; y7Tg/y7Tg + MO1-vegfd |
Fig. 5
from Britto et al., 2022 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-vegfd
1 - 5 of 9 Show all
Citations
- Arnold, H., Panara, V., Hußmann, M., Filipek-Gorniok, B., Skoczylas, R., Ranefall, P., Gloger, M., Allalou, A., Hogan, B.M., Schulte-Merker, S., Koltowska, K. (2022) mafba and mafbb differentially regulate lymphatic endothelial cell migration in topographically distinct manners. Cell Reports. 39:110982
- Britto, D.D., He, J., Misa, J.P., Chen, W., Kakadia, P.M., Grimm, L., Herbert, C.D., Crosier, K.E., Crosier, P.S., Bohlander, S.K., Hogan, B.M., Hall, C.J., Torres-Vázquez, J., Astin, J.W. (2022) Plexind1 negatively regulates zebrafish lymphatic development. Development (Cambridge, England). 149(21)
- Astin, J.W., Haggerty, M.J., Okuda, K.S., Le Guen, L., Misa, J.P., Tromp, A., Hogan, B.M., Crosier, K.E., Crosier, P.S. (2014) Vegfd can compensate for loss of Vegfc in zebrafish facial lymphatic sprouting. Development (Cambridge, England). 141(13):2680-90
1 - 3 of 3
Show