Morpholino

MO1-catip

ID
ZDB-MRPHLNO-140606-1
Name
MO1-catip
Previous Names
  • C2orf62_1 MO (1)
Target
Sequence
5' - GTGCTGCAAATGACAGCATAAGTGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-catip
Expressed Gene Anatomy Figures
shha Fig. S6 with image from Bontems et al., 2014
tbxta Fig. S6 with image from Bontems et al., 2014
Phenotype
Phenotype resulting from MO1-catip
Phenotype Fish Figures
brain malformed, abnormal WT + MO1-catip Fig. 6 with image,  Fig. S6 with image from Bontems et al., 2014
brain necrotic, abnormal WT + MO1-catip Fig. 6 with image from Bontems et al., 2014
caudal fin curved, abnormal WT + MO1-catip Fig. 6 with image from Bontems et al., 2014
eye decreased size, abnormal WT + MO1-catip Fig. S6 with image from Bontems et al., 2014
eye malformed, abnormal WT + MO1-catip Fig. 6 with image from Bontems et al., 2014
floor plate undulate, abnormal WT + MO1-catip Fig. S6 with image from Bontems et al., 2014
head decreased size, abnormal WT + MO1-catip Fig. S6 with image from Bontems et al., 2014
heart edematous, abnormal WT + MO1-catip Fig. 6 with image,  Fig. S6 with image from Bontems et al., 2014
heart mislocalised, abnormal WT + MO1-catip Fig. 6 with image from Bontems et al., 2014
inner ear decreased size, abnormal WT + MO1-catip Fig. S6 with image from Bontems et al., 2014
notochord undulate, abnormal WT + MO1-catip Fig. S6 with image from Bontems et al., 2014
peripheral olfactory organ has fewer parts of type ciliated olfactory receptor neuron, abnormal WT + MO1-catip Fig. S6 with image from Bontems et al., 2014
whole organism curved, abnormal WT + MO1-catip Fig. 6 with image,  Fig. S6 with image from Bontems et al., 2014
Phenotype of all Fish created by or utilizing MO1-catip
Phenotype Fish Conditions Figures
eye decreased size, abnormal WT + MO1-catip standard conditions Fig. S6 with image from Bontems et al., 2014
heart mislocalised, abnormal WT + MO1-catip standard conditions Fig. 6 with image from Bontems et al., 2014
heart edematous, abnormal WT + MO1-catip standard conditions Fig. 6 with image,  Fig. S6 with image from Bontems et al., 2014
whole organism curved, abnormal WT + MO1-catip standard conditions Fig. 6 with image,  Fig. S6 with image from Bontems et al., 2014
floor plate undulate, abnormal WT + MO1-catip standard conditions Fig. S6 with image from Bontems et al., 2014
notochord undulate, abnormal WT + MO1-catip standard conditions Fig. S6 with image from Bontems et al., 2014
caudal fin curved, abnormal WT + MO1-catip standard conditions Fig. 6 with image from Bontems et al., 2014
head decreased size, abnormal WT + MO1-catip standard conditions Fig. S6 with image from Bontems et al., 2014
brain malformed, abnormal WT + MO1-catip standard conditions Fig. 6 with image,  Fig. S6 with image from Bontems et al., 2014
inner ear decreased size, abnormal WT + MO1-catip standard conditions Fig. S6 with image from Bontems et al., 2014
peripheral olfactory organ has fewer parts of type ciliated olfactory receptor neuron, abnormal WT + MO1-catip standard conditions Fig. S6 with image from Bontems et al., 2014
brain necrotic, abnormal WT + MO1-catip standard conditions Fig. 6 with image from Bontems et al., 2014
eye malformed, abnormal WT + MO1-catip standard conditions Fig. 6 with image from Bontems et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.