Morpholino

MO1-septin6

ID
ZDB-MRPHLNO-140604-4
Name
MO1-septin6
Previous Names
  • MO1-sept6
  • sept6-tMO (1)
Target
Sequence
5' - CATGGTTCTCTCCTGCATCAAACCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-septin6
Expressed Gene Anatomy Figures
cp Fig. 4 from Zhai et al., 2014
dand5 Fig. 6 from Zhai et al., 2014
foxa3 Fig. 4 from Zhai et al., 2014
gli1 Fig. 9 from Zhai et al., 2014
lft1 Fig. 5 from Zhai et al., 2014
lft2 Fig. 5 from Zhai et al., 2014
myl7 Fig. 4 from Zhai et al., 2014
nkx2.2a Fig. 9 from Zhai et al., 2014
ptch2 Fig. 9 from Zhai et al., 2014
shha Fig. 9 from Zhai et al., 2014
spaw Fig. 5 from Zhai et al., 2014
Phenotype
Phenotype resulting from MO1-septin6
Phenotype Fish Figures
determination of digestive tract left/right asymmetry process quality, abnormal WT + MO1-septin6 Fig. 4 from Zhai et al., 2014
determination of heart left/right asymmetry process quality, abnormal WT + MO1-septin6 Fig. 4 from Zhai et al., 2014
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-septin6 Fig. 5 from Zhai et al., 2014
determination of left/right symmetry process quality, abnormal WT + MO1-septin6 Fig. 4,  Fig. 5 from Zhai et al., 2014
determination of liver left/right asymmetry process quality, abnormal WT + MO1-septin6 Fig. 4 from Zhai et al., 2014
determination of pancreatic left/right asymmetry process quality, abnormal WT + MO1-septin6 Fig. 4 from Zhai et al., 2014
heart looping process quality, abnormal WT + MO1-septin6 Fig. 4 from Zhai et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle cilium, abnormal WT + MO1-septin6 Fig. 6 from Zhai et al., 2014
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-septin6 Fig. 6 from Zhai et al., 2014
neural tube cilium assembly process quality, abnormal WT + MO1-septin6 Fig. 9 from Zhai et al., 2014
pericardium edematous, abnormal WT + MO1-septin6 Fig. 3 from Zhai et al., 2014
pronephric duct dilated, abnormal WT + MO1-septin6 Fig. 8 from Zhai et al., 2014
pronephric duct has fewer parts of type pronephric duct cilium, abnormal WT + MO1-septin6 Fig. 8 from Zhai et al., 2014
pronephric tubule dilated, abnormal WT + MO1-septin6 Fig. 8 from Zhai et al., 2014
pronephros cystic, abnormal WT + MO1-septin6 Fig. 3 from Zhai et al., 2014
whole organism curved, abnormal WT + MO1-septin6 Fig. 3 from Zhai et al., 2014
Phenotype of all Fish created by or utilizing MO1-septin6
Phenotype Fish Conditions Figures
determination of liver left/right asymmetry process quality, abnormal WT + MO1-septin6 standard conditions Fig. 4 from Zhai et al., 2014
determination of heart left/right asymmetry process quality, abnormal WT + MO1-septin6 standard conditions Fig. 4 from Zhai et al., 2014
whole organism curved, abnormal WT + MO1-septin6 standard conditions Fig. 3 from Zhai et al., 2014
neural tube cilium assembly process quality, abnormal WT + MO1-septin6 standard conditions Fig. 9 from Zhai et al., 2014
determination of pancreatic left/right asymmetry process quality, abnormal WT + MO1-septin6 standard conditions Fig. 4 from Zhai et al., 2014
pericardium edematous, abnormal WT + MO1-septin6 standard conditions Fig. 3 from Zhai et al., 2014
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-septin6 standard conditions Fig. 6 from Zhai et al., 2014
pronephric duct dilated, abnormal WT + MO1-septin6 standard conditions Fig. 8 from Zhai et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle cilium, abnormal WT + MO1-septin6 standard conditions Fig. 6 from Zhai et al., 2014
determination of digestive tract left/right asymmetry process quality, abnormal WT + MO1-septin6 standard conditions Fig. 4 from Zhai et al., 2014
pronephric tubule dilated, abnormal WT + MO1-septin6 standard conditions Fig. 8 from Zhai et al., 2014
pronephros cystic, abnormal WT + MO1-septin6 standard conditions Fig. 3 from Zhai et al., 2014
heart looping process quality, abnormal WT + MO1-septin6 standard conditions Fig. 4 from Zhai et al., 2014
pronephric duct has fewer parts of type pronephric duct cilium, abnormal WT + MO1-septin6 standard conditions Fig. 8 from Zhai et al., 2014
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-septin6 standard conditions Fig. 5 from Zhai et al., 2014
determination of left/right symmetry process quality, abnormal WT + MO1-septin6 standard conditions Fig. 4,  Fig. 5 from Zhai et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.