Morpholino

MO1-fev

ID

ZDB-MRPHLNO-140321-5

Name

MO1-fev

Previous Names

Target

Sequence

5' - TTCCCTCCCAGGCGATGCAGGTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fev

Expressed Gene	Anatomy	Figures
aplnra	cardinal system vein	Fig. 2 from Wang et al., 2013
dll4	artery dorsal aorta	Fig. 2 from Wang et al., 2013
efnb2a	artery dorsal aorta	Fig. 2 from Wang et al., 2013
flt4	cardinal system vein	Fig. 2 from Wang et al., 2013
gata1a	erythroid lineage cell	Fig. S1 from Wang et al., 2013
kdrl	angioblastic mesenchymal cell vasculature	Fig. S1 from Wang et al., 2013
myb	intermediate cell mass of mesoderm ventral wall of dorsal aorta	Fig. 1, Fig. 4, Fig. S2 from Wang et al., 2013
rag1	thymus T cell	Fig. 1, Fig. 4 from Wang et al., 2013
runx1	angioblastic mesenchymal cell hematopoietic stem cell ventral wall of dorsal aorta	Fig. 1, Fig. 4, Fig. S2 from Wang et al., 2013
tal1	lateral plate mesoderm nucleate erythrocyte	Fig. S1 from Wang et al., 2013

Phenotype

Phenotype resulting from MO1-fev

Phenotype	Fish	Figures
dorsal aorta decreased thickness, abnormal	y1Tg + MO1-fev	Fig. 2 from Wang et al., 2013
dorsal aorta lacks parts or has fewer parts of type endothelial cell, abnormal	y7Tg + MO1-fev	Fig. 2 from Wang et al., 2013
ventral wall of dorsal aorta apoptotic process increased process quality, abnormal	y1Tg + MO1-fev	Fig. S2 from Wang et al., 2013
ventral wall of dorsal aorta cell population proliferation decreased process quality, abnormal	y1Tg + MO1-fev	Fig. S2 from Wang et al., 2013

Phenotype of all Fish created by or utilizing MO1-fev

Phenotype	Fish	Conditions	Figures
dorsal aorta decreased thickness, abnormal	y1Tg + MO1-fev	standard conditions	Fig. 2 from Wang et al., 2013
ventral wall of dorsal aorta apoptotic process increased process quality, abnormal	y1Tg + MO1-fev	standard conditions	Fig. S2 from Wang et al., 2013
ventral wall of dorsal aorta cell population proliferation decreased process quality, abnormal	y1Tg + MO1-fev	standard conditions	Fig. S2 from Wang et al., 2013
dorsal aorta lacks parts or has fewer parts of type endothelial cell, abnormal	y7Tg + MO1-fev	standard conditions	Fig. 2 from Wang et al., 2013
thymus lacks parts or has fewer parts of type T cell, abnormal	pku6Tg; zf169Tg + MO1-fev	standard conditions	Fig. 1 from Wang et al., 2013
pronephros lacks parts or has fewer parts of type hematopoietic stem cell, abnormal	pku6Tg; zf169Tg + MO1-fev	standard conditions	Fig. 1 from Wang et al., 2013
intermediate cell mass of mesoderm lacks parts or has fewer parts of type hematopoietic stem cell, abnormal	pku6Tg; zf169Tg + MO1-fev	standard conditions	Fig. 1 from Wang et al., 2013

Citations